Description :
From Genome Similarity Track
Location :
Scaffold_1825:1370- 3410
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1825-snap-gene-0.1Conserved gene of unknown function

Sequence
2040 bases(100 bases per row)
CTCCAGTTGCTCGTACGTTCCTTTCTTGGCGCCGCGCAGTCGCTTCTGTAATGTGATCCCCGTGACGATCATCGGGACCAAGAAAATGCAAAGGAAGAGC
ACACACAATGATATCGCCAGCGTGGTGCCAAGGATATTGGTGCAAAGCGAATCGTGAACCGCGTTGAACGAGATGTTGATCCATCCACAACTCTGTGAGC
ACCGGAGTCTCTCAACGGTCTCGAGGAGTTTGCCGACAACACCACTGCTCTGCATGAGCGTGTCGATGGTCGACTTGCGCACCGTAGCCAAACGAGAGAA
ATAATCATCGGCAAACTCCATAACGGAGACTGTGTAGTTCCAGTTATCCGAAAAGCCTTTGCCAGTATCCCCAAGCAGATCTTCGCGCATCGTATCAATC
ATGTCGCTGATTTTGTTGAACGAAAGCACGTAGTTGTACGCGTTCGTAAATGCCGTCGTACATTTGTCTTTAGACGAAGCTGGATTTGTTCCTGATTCGC
ATTTGCCTTTCATGAAGCAGATCGGAACATCATCTGAATTCAAATTCTTGCTGTCGCATTCGAAGGTTGCAGGCGATTCACCAGAATAGAGCACCCAAGG
CGTGACGACATTTTCCTGGGTGAAAGACTTAGAGCCAATCTTGTTCACATCGGCAACAGCGGCGTTCAGCTTCGATAGCAAGTCACGCGACGTAGCCGAG
TCGAAGCCAAAATCACGAAGCCCATAGTCTGAAACTTTCACACCATACGCAGAAGTCAGCGTTTTGAACGAGCTGAAGTCGGTGCTTTTGACCTTGGTGT
ACGTATCATCCATATAGCAGGAGAACGCAATTTGATCTTCTAGCTTGAGCGGCTGCAGAATGCTGCTGTCATTGAAGCACGCATTTACGATTGTTGCCAT
TTGACGTGGAACGTATGGAGACACATCGGCTTGCATGATGTTCATGTAATTGCATGAATCATACCAGACAGCGCCAACCGCAAGCAAGGATGCCGACAGA
ACGAAGCCCAAAATGCAGACGAGAGTTCCCAGGATCCAACTCACATGGAGCATGTGAACCCATGCACTCTTTTTGGTGCACACACCTTTGAAGATCGCGA
AAGCGCCGAGGAGGGACGAAATTAAACCGAAAAAGAAAACGGAGAACACCAGCGCCCCTCGTGAAAACGAGTATTCATCAAAAGTCTCCTTCACAAGTGT
CACCACTTCCTTGGAACGCTTCGTCATCGTTTCAACTCCCGATATTTCCATGTTCGCCGTGCGAATCCCAGTGAGAATATCCTTGGATTTGTTGACAAAC
ACATACTGAAGGCTTTGCACTGAGCTGGCCATAACCCCACTTGTATCGGACGCAATGCCGAATGCACTGCTGACGAATGCGTTGAGAGGTGATCCACAAA
TGGTATCAGGGCAAGCAATACAGGACGTGCTATTGATATTGCACGTCTTCAAGGGAAATGGTCCTTGTGTCGAATAGATCGTATTGTAGTCTTGAATCAT
TCTGCGTAACTTCTCTCCATCCGTGGCAATCCACTCCAGCCCTTGAACCTGAGCACTCACAGACGTAGCAGCCGATTGGATTTGCGATTCTGCGTCAATA
AGTGGTGCTTGGAGGTTGGATGCAAATATGTCGATGTTCACAAGTGTCACGTTCAGGGAGTTCAAAATCCCGTTCACGCCATCTGAAATGTTCGAGTTTT
GGGCGATTGTCACAACGGAGCAGATGAACACAGCCAAAGTACACACCATGAAGATCACACTTGGGATGAGGATGTCGCAGCGGGTGTATCCTTTCTCCTT
TGGATTCCGCCCACCACACTGATTGAAGACACATCGCAAGACAATAAATCCCACGAACGCAAGAGACGTCAGCACTGCAAAAACAATCCCGGGGGCGACA
AACGGTGCTAAGCTGCTTGGATAACCCTTTTCCATCCATTTGGTCGCCGTCGTGACATTATCGGCTGTGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN