Description :
From Genome Similarity Track
Location :
Scaffold_1069:137- 7044
Sequence
6907 bases(100 bases per row)
AGCGTCAGGTCAAGCTTGTTTGAGTGTGTTATGCCTGTCGGTGAACTCGAAGCTCTGTAGTGAGGGTTCATCCGGCAAGACCAAGAGACTTTGTGTATTG
GCCGATTATTATCGGGAGGTTTTACGTGACGGCTTATTGTTGCCTATTTGCACGACTGGGAGTGCTTGAATTGCCTCCCTTTTATTTCTTCCAGCCGAGT
GTTGAACACTCGGTGATCTCGTAAAAGGCTTACCCGTGCCTGGTACCCTTCCGCTGTTGGGACCACGAGGATTCAAAACACCTGCTAGCTTTGCTCGTGC
TAGTAGCGTGTTCTTATTTTACTGGTTGGCCTATATAAGTAGTTTACAAGGTCCAGTTTGTCCCGGTGCAAGGGCAGAACTGGGGTCTTCAGGTCCGCCC
GAACGATCGTTTACTATCCTAGTAGACGTATTGTTGTGGGAACATCCTAACTACATCTGTAGCTAGAGTTCACGTGGGATTTCCAACACCACAGTACACC
TGGATCTGGGCGGGATCCACCCTTTCAGTGTACACGTGGATCTGGGCGGGATCCACCCTTTCAGTATACACCTGGATTTGGGCGGGATCCCGGATCCGAT
TGGATCTGCGCCTGGATTTCATCCGGATCTAGCGCCAATGACCCAGGATCAATTGGGTCAGTATAGTTGGGGCCCTTGAAAGCTCGTGCTTGAGATCAAA
CAGGACTCCTCGCACGTAAAACGTCACTCTTATGCATCAACATTCACTCCTTCCTCCTAATCCACCCTTCCCCTGTGGATTCGTCTTCTCTTTCTTTCCG
ATGTGACCAACTCACATCAGCGATCCTCCTCCTCCTGGCCCACACCCTTCCTGTGGGCCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATG
GGTCCCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCGGTTACGGTTCGTACGATCCCTCAAGAAGTCATAGAGTAATGCTCCACAGTTCAGA
TCTGCCTCGTCTACCCAACTGGGTTCGTCATATTCACGCCAATACACCAGAAATTCACGGTAAACCCGTCCGTATCTAGTTCGTTTCCCCGACCTCATAT
CGGTGATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCAAAGTCGACGCGATCGGATCCATC
CACCGAAAGACGGATCTGCGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTT
TCCAGCCTTACCGCGTGTTCTCCAATCTTCTTGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCTTTCACCCGATCCA
AATAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTT
CACCTGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTGCATACTGGAATGGCCGCT
TCCAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTG
CGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACGTACATCTTAATGGCTCTCGTGATCGTCTGTACCATGCGCTCGGCCGACCCGTTAGCTTGGGG
ACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATC
TCGCTAGCTCCAAATTTTCGGAAAACGCACTCCTCGTACGATTCGGCAATGGTCTGCGCAGTTCTAGACGCACTAGCTTTGGCTACCACGTATCCGGTAA
ACAGGTCCACCCAAATCAACAGTTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTG
GATATTCCCAGGTGACTCCCCTTCGATTGTGGGTCTGCCCTTGCCTGTCTCACAATCCACACATTTCCCGACATACCGTTGTACGCTCTTGAATAGTCCC
CTCCAGTGAAAACATTCCCGGACCGTTGGTAGGTCTGACCAATACCCTGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAA
GGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACCGTGTA
ATCCGATAGCGATAATGCCGTAGGTTTGGCATCTTTCCCGACTCAGGTCTCAAACATTCCCCTAATCAGAAATTTCATTTGGTCCGAGGAACACGAGCTT
CACTCGTTCAGGTCTTTAAGGAATCACGCTTGCATTGGGAAGTGTTTTGTACAAGAAAGTTCCGAGCAAAGATGTGGGAGGTANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNAGGATTCGCCTCCAGTCCCTCCTCGGAGACTCGATGACCTAAGTAATCCACCTTGCGCATCCCTCAATAGCTCTTCACCACGCCGATAG
AGTGATTCCACTTAGTACACGCCTTCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTCCGCCGGTATTAGAATGTCGTCGATATAAGATCT
GCGTCCTAACACAGATGGGATCCCAGAATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTGTGATCTTCCCCGGATCCACCCCTGTCGGGTTCC
GGTATTCGGGTGAACCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGGC
CAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACGGTACCAGAGTACTTT
ATCCAAATCTTCCAACAGCTCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGGCTGTTAACCAGCCGGTAATCAATGCACATACGTATATCC
ACCCCGTTCTTTTTGATGATGATTACCACCGGAGATGCCCACGGGGATATTGAGAAACTGATGATCTTGGCTTGAGCAGGCCTTAATCAGATCTGATAGT
TTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTTTGAGCGATCGGGTTCGCGGAGTCGACTCGATGTCACATTTGACTCCGCGGTTGCGGAGGTCAACC
ATGTACATTTACAAATCAGAGAAAGTCGGGACTTACAGATTGTTCGAGCAGACTGACTACTTGAGTAGCTTCACTCACCCCCATATCCTTTTGAACATCA
TAAATCGAAACTTCTTCTGCGATCGAGGGCAATGCAGACATCGCCGATAAGACATCGCAGAGAGCCCCTTCACATAGGCAACAGAGTAGCTCATCTTCCG
TCTTCGTAGGATCCACCTTTGGATCCAAACACCGCGGCCCTCTTTCGCCGGGCAGTCCTTCTGTCTTCGGGGAATCAGGTACCCTGGTATTAGGGAAACC
ACCAGTTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCCCGACAGTTCGGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAAT
GGAGAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGCTCGGCTTTAGCCCTCTGCTCTCCTTCATCCACCGACCCTGCGTTATCTAAGAGCCGAC
TCTGGGGATCGTCCCCTGTCCTGGATCCAACTTCCATTGTTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGGAGGCCG
ATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTGCACCAGATTCTGCCATTCTTTGTAG
CGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCTAACCATCACCCGATCTCCTCATAATGGTCCAGTATTAGTCTCTTGT
CGCTGACGTTCGTGACCTGGAGGTATTACGATCGACCTGGTCCCTGAATTACGGTAGGCACCCATTTCTCGCCCCGAGTGATCCACAGTTTCTCATGTTC
CACCCACTTCAACCGATCTGGCAATAACCAGGTTTCTCTGGGCTCGATCCAGGTCGTCTTATCCGCCCTTATGATCCTCATCTTCGCCCCGTACAACGGT
CGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCACCCTCACTCCGGCTGGCACCATGAAATCCATCTCGA
GGATGACGTCTTGACCAGCGAGATCTCCAACCCAAATATCAAACCAGTATACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACG
GTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGTGGTATCTAGTATAGACACCTCG
GCACCACTATCTAGGAGAAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGAGCATGGTACTTCCAGTATC
CACGGGACTCCCCGGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGATCCAGTGACCTGACCGACCTTAGGTGGATCTGCAGTGACCTCACC
CTTGGTAGGCTCAAACCATCGGCCATGTTGGCGCTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCA
AACTCATCCACTTGGCGCAAACTAGAGATCTTGACAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATATAGGGTCCTGCTACCTGGATCTA
GCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCC
ACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCGTGAATCTCGC
CACACCCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACACTTTTTCACAGACCAGATGTTTCCAGCATCCCATATTCAGTGTGC
TTCCGGG