Description :
From Genome Similarity Track
Location :
Scaffold_1289:137- 2457
Transcript NameFunction/comments
Phyke_g11742hypothetical protein PHYSODRAFT_262200

Sequence
2320 bases(100 bases per row)
agtccatgtggtcacaccgtggattacctcagtccatcaatccattctcccaggaaagatggactaggcttcaccacacaaGCTCTACGCGAACTTGAAG
AAGTGTGTATTCTGTGCACCGGAGATACCGGTGTTGGGCTGTTACGTGAGCAAGGACGGAGTCCGCGCTGATCCCGATAAGGCCGTGTCAATCTGTTCAT
GGTCGACGCCTGCGAATCCCACTGAGCAACGCCAGTGGTTGGGCATGGCAAACTACGTGCACAAGTACACGAAGGACTATGCCAAGCTGATTCAGCCACT
GTCGTTACTGCTGAAAAAAGACACCACATGGGCGTGGCGACCAGAACACCAAGACGCTTTTGACTcggtgaagaagagtctGGCGTCCGCACCTGTCTTG
ATACTCGCGGACGAAATGAAATCATTCCACGTCGTATGCGACGCAAATGACTTCGCCATCGGGAGCGCCCTGATACAATTCGACGACGAGGGTCAAGAAC
AAGTAGCCAGCTACCAGTCCCGCCAGATGAAGCCAGTGGAGAGGAATTACCCAGTACACGTCAAGGAACTCCTCACCATGCGCTACGCACTGATCAAGTT
CAGGGTTTACCTACTGGGAGAGAAGACGTTTGCCATCTACACCGATCATGCATCTCTGCGGACAGCGATGAAAACGTCTCACATGTCCCAGCGCATGGCA
CGCTGGCTGTCGTTCTTCTCTGAATACAACTTTGTGGTGCATTACAAGCCCGGCAAGAACAATATCCTCGCCAACGCACTGTCTCGGCGTCCAAATTACG
ACCCGCGCGGAGCTCTGGGACGTCAGACAGCTGACGAATATGACGAGGCCTCGTGCGCGACGTGCGTGGCGTCAGGTCTGAACCTGACGAGTGTCGCTCC
CAAAATGTTGCTACGTGAGGAAATTGCCACCGTGTACGAGCGGGACGCGCAATACGCCAGCATCCTGGCGTATCTTCGCTCATCCAGTGACGCGACGCTG
GAAGTGCTATCGCGTTCAACTCGCAGTCGCATCGAGCGCTATCACCTCGATGGCTCCTTGCTGACGTAAGCCATCGATCGCTTCGATGCTCCAAGGGTGG
TCGTGCCGACCGATGAGGACCTTCGCGCTCGGATCATCCACGAGTATCATGATTCCCCTATCGGAGGCCATCTGGGGCGCGAAAAGACGTTCGTGGCAGT
ATCGCGATACTTTTTTTGGCCCCACCTGTACAAATGGGTTCGCAAGTGGGTGCGTACTTGCGAGATCTGCCAACGCATAaagccttctccatcgtcacag
GCTCCACTGCGTCCTCTTCCGGTCGCCACGGAAACCTGGTGTTCGGTGTCCATGGATTTCATCTTCGGGCTGCCGCCCGATGCAAATGGTCGCACTGGTG
TGCTCGTGTTCGTGGATAGATTCAGCAAGATGGTCCACTTCGTGCCCGTATCTACGTCGGTCTCCGCTGAGGAATCCACGGCTCACTTCGTTGATACTGT
CTTCCGTCATCATGACCATCCTGAATCTATCGTCTCTGATCGCGGTTCACGTCCGCGTTCTGGTCCAAGTTGTTCGAATTACTGGGTACGAAGCTTCTGA
TGTCTACCGCGGCACATCCGGAGACGGATGGACACACTGAACGTGTCAATCGCGTTCTTGAAGACGTGCTCCGAAGTTACGCGACGTCGTTCACAAGCTG
GAGTTCATTTCTGCCCCTCGCCGAATTTGCCTTGAACAATGCCGAACACGCATCGACGGGGGTGACTCCATTCTTTGTGAACTTCGCGCGTCCCTGCAAT
GCTTGCCGTGGGCCACCCCACGGAACTTCGTGACTTCACCCTCGGTGGGGGAGGAGTATCGTCTGCAAGCTTAACGCTGGACAAGACGACACCACCTGTA
TCTCCGAGTGAAGCCAGTGCCAATGCTGTGATGCGAgctcagaagaagaaaccctTGCTTCGCCGCACAACGCAGCGTCTCCCTTCACCGAATGGACAGA
ACGAGCACTGATCGACCCTGGCAGTGTCCCCGTGATGCATCAACACAATGCGCCTCTCACCAAGTACGCCCCGAAGCCTGTGGCTGGTCCAGCCGATCAC
TCGGCGGTTTCCAAGTTTTTACTGCAGCGACAAGGCATCTCGCGATTTGTGCGCGACgcactgcaagctgcagtggataAACAGAAGCAGAACGCAGACA
AGAATGGTCACAATAATGTGGATTCATTTCACACGGGCGACCGTGTGTTATTATCTACCAAATGCATCTGATCCTCAGCTGTGACTAACCTAGGTGCGAA
CAAATTAACGCCGCGTTACA