Description :
From Genome Similarity Track
Location :
Scaffold_3935:137- 1751
Sequence
1614 bases(100 bases per row)
CACCAGCCAATGATCCCTCTCCCTACTTCTTCTTTCATGATGACTGCATCTGGCGAATCCTGTTTCGATTCGTACGATCCCCGCAAGAAATCATAGAGTC
ATGCTCCACAGTCCAGATCCTGTCTCGTCTACCCAAATTGGGTTCGTCATATCCACGTCAATACACCAGAAACTTGCGGTAAATTCGTCGGTATCGAGCT
CGCTTCCCTGACCTCATATCGGAGATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCCTCGAAAT
CCACCCGGTTGGATTCATCCACCGAAAGACGGGTTTGCGGCCGGTCCGGATATACCTTGACCAGCTTCAGCTTGGATACGTGTACTACAGGGAACAAGCG
ATATTCGGTACTTGCCGTGTCCAACTTCACCGCATGTTCCCCTATCTTTTCGCATACCCGAAACGGTCCGTGCCATAGATGGGCCAATTTGCGGGCGCAC
CCTTCCTTCACCCGATCCAAATATAGCCACACCTGCGATCCCGCTTGGATTTGATGCGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCG
CACTCCGCAGCCGTTCGTTCACTTGGGATCAGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGGGCT
GCTTACTGGAATGGCCGCTTCTAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAGAACGGGGTATCACCTCGGATCCTATCTTGGGCGGTGTTCATC
ACGAAAGGGGGTCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATTGTCTGCATCATGCGCTCGG
CCGACCCATTAGCTTGGGAACGGTATGCCATGGTTGCTCGCTGTCTCTGCCCCAGGATCCGGTTGAAAGCTCGAAAGAAATCAGACATAAAACCTGGCTC
TCGGTCATGTCTAATCATCTCACTAGCCCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCGGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTG
GCTATCACGTATCCAGTAAACAGATCCACCCAGATCAACAACTCTGTGTTTCCTTTTAACGACTTGGGTAACGAGGGGATATGATCCTTGGCTATGATTT
GGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACATTCGCCGACATATCGTTG
TACGCTCTTGAATAGTCCCCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGATCAATACCCTGATGTCCACCTTCTAAACTAGCGTGATAGTGG
TGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCTCGATCCTCGTTGACTCACTCTCTTCGTAGGGGGGCAATAGAAGAGC
AAGTCATTCAGATCCACTGCACAATCGGTAGCGATAATACTGTAGGATTTGGTATCCTCCCGACTAAGGTCTCGTACATCCCCCATCAGATACTTCTTTA
GTCCCAAGATCCAC