Description :
From Genome Similarity Track
Location :
Scaffold_10:137- 1562
Sequence
1425 bases(100 bases per row)
GGAGTTGAGACTCCTAGTACACCGACGTCAACCATCTCGAATGCCACCAGTCGCGTTTGAATCACGAAGGTCGGGTAGCATTGCCAGCTGTGCGACATCA
ACTCGCTTCCTTCGTGAATGTACACCGTTCCAAGTCGAGTTCTTCGACACTTACACTCACACACTGTTCATATTTCAATTGGAGTGGACGAACTGGAGCA
CTTGGTATCATGTGAGCTGGTGCGTCCGAAATATCTTCTTCAACGTTCCTGGTCTCAGGCATTTCCCTACACATACACTGTAATCGAATCGAGAAATTCG
TCACCGTCGGAATCCGGATCTTCAACAGTGCACACTTCGAACTCTGACTTATCTTTATCTGAAGTCACATCAGAGACGTCTCGTAGAGCATTTTTACCAA
TCGCATCTTCGTTTGAAACTTCAGCAACCTTGGGATCTTCAGTTGAAGTAGGCGCCTGACGTGAATCCTTGTCAGGCAACTCATTCTGTGTAGATATTTG
TGTTGAAAGCAATGGCATTGCGGTTTGAAGACGCATTTCAATAGGGGCTTTAGCGCTGCTAACGGCTACTAGGGCTCGCTTATGAAATTCCTGAAATGCT
TTGCCTAAAAGTGAATGCTGACAGATCTTACCAGGAAGATCGTCAAACAAAGCGGCGCAGTCTTGAAGAAAAACAGAGCGAAGGGTCGAGGAAGCCACGT
GCTGCCAAAATTATCCTCCCAATCTCCACCTACACTTTTTTTTTTATAATACTCGACTCCAGGAAACACAAGGCGCTGGAGCTCTGAAGGAGGATCGTCG
GATGCACGATCTAGGAAGTAAAATCGAGCCTTTGGTGGATGACCTGAAAGCGCATGCACCGCTTCTTTAGCTGTGTGTACGTATCCATGCCTCATCCACC
GTGTCGTCTAGTCTGAGAAAGTCAACGGCCACAAACTCTTGCTGCCTTACGTCCTACTGTCGATTGATATGCTTTTTTTTTATTATTTAATGAAAGACCA
AGACGGTCGAACACACCTTCGTAGCTCTTCTTGTGATTCTCATACGTGATAGATTTGTTCGTGGACGTCGCTGTAGCAGCTTAATGTCACACCAGTCCGT
TGATTTCTTAAACGACGAAAATGACTCATGGTGTGGTCGAAATAGCTGAAAAAGGTATAATGCAGTAACTCCAACCGGACAAATGTGCACACCCTTGTTT
CGCATATATCCAACATGCTGTATCTTGCCAAACGTATTAGTTTTGCCTTAGAGGAGTAAAAGAACAAGGGCGCTGCATGGCTGATAGCCCTCGCCATCCA
ACTTCTGAGTGAACATATTTGCAAACTTTAAATCACGAGCATTCTCGCCACATAATAATCCAACGTGGGAAGGTAGAAACGCTGTACATCCTCGCAGATC
ATTTAGCGTTAGGAATGCGTCGCAA