Description :
From Genome Similarity Track
Location :
Scaffold_474:137- 1350
Sequence
1213 bases(100 bases per row)
GAGAATCTGCTGCAGAAACTCAGTCGTCAACTGGCCAGGCCGCGCTGGGACCTCCGAGGGGCTCGCCATGGTCTCCACAGACGAGTGAGAAGGGTCCCGG
CGTTTCTCGAGTCTGCATCGCGTTGGTTGCGAGGACGAATTTGATTGGCCGTATTTGGCCTCAGATACTAGTACATTACCGGCCATTTGCAACCCAGGTT
GTATTTCTAGAAATCGCCACCTATGGTATCGACCAGGATTGTTGCTTGTACTGTAGCCAAATGGTACGGTATCGCTTGCAACTTCGGTTGCGCACACGGT
AGCAACTTGCTACTAGCAAGTATTAGTCTGTTGTGCAACTCAACTCCTATACAAACTGCAAGTCACGGTAGCAAAACGACGCCGTATGGGAGACAGTATA
CAAAACACAAGTGAATTCGTTTATGCAGGGTTGCAAAGCGTTTATCACCGTGGCAAGCCGTGGCACCGCCAACGGCGGCCTGGAGCTTTCCATGGCTGGT
CGAACCAGCTCATACTGTCGTACCTGCACGTAGTAGGAGGTCACGTCGGAGCCGAAGGCCTGTTATGGCGGCGGGGCTACCGGTAGAGCTAGCTCCGCAC
CCTCCTGGTGCTGCTGCACAACCCGTACGATTTCATGCAGGCTACCTCTACCACTTCCTCATCTACGGCTACAAGGTAGGATCAGAGGCACACTCTATCC
AGCTCTCACTGAGATGAGAGAACGCAGGTAAACTGTGTCATCATTTCAGACATCTTCACACAAATAAAAGCCAGCCCGCCAGACCTACCGCACAGTAGCA
ATCTGCGTGAAATGGAAGCCGTCCCGCGGCTACAGACTCATAAAATCGGTATGGAAGGACCCCGCAGCAGTACTGCCTACACGCGTGAGCTGTTGCCGCT
CTGTCGAAGAAAGTTAAGGCGTTCAAGGAGTACAAGGCCGTGACCAGTTCTCGCGGTCGGTACTGCACCTACGAGAGCGACGCTAGTGTATTACAAAGAG
GTTCTCGCAGTCAGTACTACATGCACAAGAGTTATTCAGCTCATTTCACAGCGCGTTGCTCATAAAGCAACCTCAAAGGGCTGCAGCAAAGTGACACATT
ACCTGGTACACCATTTTTAACCAATGAGATGACGGTTGCAAAGCTGGTTGCTGAACTGGCTGGTATTTCAGAAATACTATTTCTACAGTGTAGTTGAAGC
AAACCGTACTTTC