Description :
From Genome Similarity Track
Location :
scaffold_47:13699- 14828
Transcript NameFunction/comments
g2024.t1hypothetical protein

Sequence
1129 bases(100 bases per row)
GAGGGACCTGCGGCTCCAAATGAGAGGCGACAGAGAAACGGATGCGCTGGTGGACATGGTCGCGTACAGCGACGCAGACTTCGCGGCGGACAAGGGGGAC
CGGAAGTCCGTCACGGGCGGTCTGGTGACGATGGACGGGATGCCCGTCAGCTGGATGAGGCGGAGTCTCTCTGTCTACTATGGAAGCCGAGTACACGGCG
GCGTCAGTGATGGCTACGGAGCTTCTGGGCGTGCGCGAGCTACTTGGAGAGCTGCGCGTGAAACACGAGGTTCCGTTGGCGCTTCGTGTTGACAATGTGG
TGAAGCGCGAATAAGAATTTCCGAGAAAGGCGATGGGAGCCACGACATTGAAGATTGCGCCCGAGCCTGGATCAGCAAGGTCAAGTCCGCGTTCCAGCGA
GATCAAGCCACCGAGGAGGAGAAATGCCTCACCTTCGCGGATCTCATGATCGGTCCGGCGAAGAACTGGTACCGACAACTAAGTCGAACGACCAAGACCA
AGTGGGCAGATCTACTTGACAGTTTCCAGACCCAGTACTGTGGTCTAGAGATGTCAGTGGCGTGGCAATACTACCATGCGCGCAAGCGATCTGAAGAAAC
CCCGCTCGATTATCTCTATCGTCTGAATGTGGCGGCTCTGCGAGCCAAACTCAAGATCAAGGACGGAAATCCCAAGGCCCGCCGGGAACACGTCGATCAC
TTCATCGAAACTTTGGGTGATCCCGAGCTGGCTGATCGTCTGACCCTGCTTCGACTAACTGACGTCGACGATCTGGAAGAGATCCTTCGTGCCCGAGAAG
GGGCGAAGAGCAGACAGCGACGATCGGCGTTTGGGTCGAAGTATCGACAGAAGACTCCATCGAGCACGCCCACGGCACCCGCAAGGGCCGTAGTGCGCGC
GATCCAGGCCCAAGATCCGAGTTCGGAGTCAGAAGGGATTTCCGGATCAGAGGGATCTGACTCTGAAGGAGATCTACGAAGGATCTACCTGGCCGCGGCT
GATGATCAGTCGATCGGTGCTGGGGGCGGGTCCCACCCGCCAGATCAGGCGCGATCTCGCCCGAACTCGCAAGATCGAGGCCGGATCTCCGATCACCGGA
CCCATTCCGATCGTGATCACCAAGATCGA