Description :
From Genome Similarity Track
Location :
Scaffold_316:13696- 14945
Transcript NameFunction/comments
Albla_Nc14118610predicted protein putative
Albla_Nc14118620pyruvate dehydrogenase putative

Sequence
1249 bases(100 bases per row)
AGATTGTCCAGCGCCTTTGAAGGCTTCCGAGTCAGCGGTACCGGTGTCGTTCTCGAGGTCAATCACACGTTCCATGTGGTGAAAAAGCTCAAGCTCATTG
GTATGCCGACAGAGATACACAAACACACGGCCTTTATCAAAGGAATGTTCAATTCCGAGCTGGAAGTCGCCAAGTTTGAAGGTGCGAGTATCCGTACGGT
CTCGGGCATTCGAGGTCGAGTGAAGAAGGCGATCCATGGAAGCAAAGGCGACTTTCGTGCCACCTTTGAAGACAAAATCCTCAAAAGTGACATTGTGTTC
TGTCGGACTTGGATTCCTGTGGAGCCCAAGCGCTTTTATAACCCCATCACATCGCTGCTTTCCACAGAAGCGCTTCTCATGAAAACGACTTTCGACATTC
GAAAAGCCCATAAAACGCCAATTCCTGTCAAGAAAGACTCTCTCTACAAACCAATTCAACGCACAGAACGCAAATTCGCACCGCTCAATGTCCCCAGAAA
GCTCCAAGCGAGTCTTCCGTTCGCCAATAAGCCCAGCATCGACAAGAAAAAGACCAAGCAATCGTACGTGTCCAAGCGCGCTGTGGTCCTTGAGCCTGAG
GAGAAGAGGAAAATCGCATTCATGCAACAAGTCAAAGCGGTCAAACGCGATCGAGTGGCCACACAAAAGGCCCAACAGAGCCTGAGAATCGCCTCGAGTC
TCAAGCGTAAAGCCCGGGAAGAAGCCAAATTTGAAGCGGTCCATCGGGAAGAAAAACGACAGCGATATCGCGACCAAGGCAAAGCACAAGCTCGTCAACG
TGAATAGATCCAAATTGAATGCAACTTCGCCCTTGAGGGAGTCTATTTATCACACTTGGCTTCATGCAAGCAATTCAAGTAAATGTACGCGTCCAGGCCG
TGTTTCTCCATAGGCATGAATGTGAGCGCTCCACCAAAGTACCTGGCGTATCGAGAAGCTACACGCAGCCCAAAGGACTCGTAAAAGGTCAGACCGGAGG
CTCGATGCTCCAGATCGGCCGCTACTGGATCGTACTGATTGATATGCCCGCGCGTTTTGAGCGCATTTTGCGCTTCTTTCGGGCGAATGTATGAGAGCAA
CGCATTGGCTTTGTCACGTGTCATTCCGCTTCCTTGATCCGACACTTTGATACAGATGCTGTCCTTCCCTCCAGCAAAACGAATTTTCACAGACGGAGGC
GTCGAATTGTCCTTCAGATTCGATGCTTTGGTCCAAGCATTCATACTAT