Description :
From Genome Similarity Track
Location :
Scaffold_304:13695- 18761
Sequence
5066 bases(100 bases per row)
TTATTACCGTAAGTAGATGGACTGATGGTCGTACACCCGTCATATCCAACGCCAACGCGCACTCTAAACCGACCGCCGAAGGATATCGCAGAGACGGTCG
TGGGAGAAGAGGAAGCAAAGTTTGAAGACGATATGCCGATATGTGATCCCGTGGAAGACCAAGATAAACTTAAAGGACCACAACCAGGACAATCGCCAGT
GGTTATTAACGCGATCAACATACCTGGTAGGACTAGTGACGAGGATGACGGCGATGTGGTTTGTGATTCGGTGTCGGATCAGCTGGAGCTAAAGAGTAAA
CCCCAGAGAGACATATCGACGCTATTACCAGCGACAGCCGACATAGACACCCCCGTTGACGTGATGGAAGACATTACGGTGGTGCGGGACCAGTCCTAAA
CGCAGCCAAACGAGTGCAAGGGGAATCTCACTTCCGAACCGATCAAGGATATGGTATCTGATCGTATGCAAGACCAGTCCACCAATCACCTAGACGGGAC
TACTGTTAAGGATGGTGAGGTGCATCGACCGTCCGACCATCAGGTGAACCAGAAAGCAGCGATCACAAGCGAAGGAGCACGCAAATGCTCGTCATACCAA
CGCGAAGGTGGAGTATTTTTCGCGAAAGACGTTGGCCAACACATGGCAGTCTTGCCAGAAGTAGACGTGATGCTGAGCGAGGTAAAAATTGACGCCATAC
AGGTGGGCGATCCAGGGGTCCCATTGACCAAAGAGCAAGAGGAATTTTGTCAGCTGATCTGGAAGAATCGACACCTTCTGATGGGCGAAGGAAATGCCCT
CCCACCTGCTGCTCGAGGTGTAATCTGCGATATAGATGTTGGAGGAGCGACCCCAATCGCACAACGAGTAAGGCCAGTCACCCCAAAGTTCCGTGAAAAG
TTGGCGGACCTAATCAAAGGGTTACTATCGGCAAGAATCATATTTTCCTCAACTTCGCCATGGGTGTCGCCGATCGTAGTGATCGTGAGACGAATGGGGT
GAATATACGACTGTTTATAGACTACCGAAGAGTTAACCAATTGAAGAGGCTGATGGTATATCCCATGCCCCTGATTAACGACTTGTTGCAGGATCTGGAA
AAAGAGCTATGGTACTGTTCATTGGATATGGCCAGCGGATTCTGCTTTATGGAGCTGAAGAAAAGAGCACGAATGATCTCTGCTTTTATCACGCCCTCGG
GTCTGTATGAATGGTGACGCATGCCGTTCGGTCTGAAGAACGCGCCGCAGATAGATCAACGTATGGTGGATAATGCGTTATATGGATATCTTATGATCGG
GGATCGGCCGAAGCCAAGTGACCACGAGGCTTCTCAACAGGCCGATGTGTTTACGGATGGCGAACTAAACCCGCACCGGAACCCTTCGGTTCTAGGAAGA
AGGTCCTACGTTGATGACATTCTAATCCCAGTGTCATCCTGTACATCTCTCTATAGAAAGGTGGAAAGATTGTTGGAAGTGTGTGATCAGTGGAATTTGT
CGATCAACCTACCTAAGAGCGTCTGGGGATGAAACAAGGTTGAGTATCTCGGGCACCGAGTGCCAATAAAAGGAATCTAAGCTGACCCGAAGGATCTGGG
GTCGTTGGTGAATATTCCTTTCCCCAGACACTGCGGTCAATGCAGCTCTTCCTAGGAAGCTTGAATTATTACAGCTGGATCATCGAATACTTCACCATAT
ACGCTTGGGTCTTGTACGAATTGAGGGAAGCTGATTTTCATGATATCAGGCGTTCGCACAGCACGGAAGTTGAAGGCTCAACCATCTATGATCACGGCCA
TAATACCCATATTGATGATGACAGCGGGCAGCGACCAGCAGGTGATCACGATCATCCACTGGTGACAACGAATGGTCAGGTTCCAATTAAAGTTAAAGCG
TCCAATAGAGAACATACTGGTGCTCATCGTTGGGAGAAATCCATGATTCCGTTCACCATGTTGAAGGCTAAAGTAGCCCAAACCCCGGTACTCAAACATT
TCGATCCAGACCGCCGACCAGTGATCGTGGTTTACGCTTCCAAATGGGCGGTACCCGCAGCTTTGCTACAGGAACATGATGGATTGAATTGGCCTGTTAT
GTTCACAAGTCGATCGCTACATCCAAATGAAGTTTATAATGGAGCGGTAGAGAAGGAAGTTCTGGCCCTGCTCCAGATGTTGGATATTTGTTATACGCTA
TCGGACTCTCGGGATTTTGAGGTTCTCACAAGATATTCTACCTTGGCATGGTTAATGCATTCATCAGGTCTCAATCGAAGACTTGGCAGATGGGCAGCTT
TACTGTCGACTTGGACTTTGGAGATTAGTCGATGTAACAAAGGGGAGGACGAAATCCTCGGCAACCTCGCAGCGTGTATTACACCGCGGAAAGATATGGA
TGAAATGTTGATCACGATCGAACCACGGAAGCAACCGAGACAGACTATCAGCACGCCTATCCCTACGATCAGACGTGGCGAAGTGCTTCTGGTCGTCAGC
TTTGACGGATCATCACGTATCAAGGAAAAGGGGGGCGCCTACAGTGCAGTGAAATGGAAATTGCCTGAGTGGACCATTTTGTCGGCTGCGTCGCGCTTCG
ACACTGGATTAACAGTAAACGAGGCAGAGTATCACGGGTTTCTGCTGAATTGCGACCTGCTAGTGAAACAGACAAGGGGACGAGTGGTCATTTGTGGGGA
TTCCAACCTGTTCATCAGGCAGATGCAGGATGAAATTGATTGCAAAGCACAGGACCACAATTACTGCGTCTCAAAGCCCTAGATCGACTTAGGTCGTGGC
CGACACATAAGTTCTGACACGTCAAGAGCGATTGGAATCAAAGTGAGGATCGACCGGCTAGTACCGCTTAACAGTTGGAAAAGAGAATGGTTATGCTAAC
TGATCAGGACCACCATGATCTGAGAGTTATCGACCGACTGGACGAAACATTGATGCCAGCGGGCAATGATCAAGTGATCACGACGGCGGTGATTACGCAA
TCGACCATGCGAAGGCGTGAGTTACTCATCATTATGCAAGAAGAGATAATACAGCAGATGCGACTCGACCGTATAAAACAGGCTTAAGACGAAGAAAGTT
GGATCGCCAACCTCAAACTTTACCTAGTCGGAGATGTTACGGAACTGGGTGCTACAGAAGCTAAAGCAAGTGCTGTGATTGCCCCAGAATACGTGGTAGA
TGAAGGCGGATTGTTTTATCTCTGCCCACGATCGGCGACAAACCCCGCCGTGCTGAGCTCGTTCGTTTGGTAATCCCGGAGTTGCTTCAAGATGATATTC
TACACCACTACCACGCAACTCTATAATGTGGTCACCAAGAGGAAGGCCGCACGTATCATCTTGTGCGATCACACTTCCATTGAAGAAGTTTGTTCAGAAG
CGTGCAATAGTATGTGGGGAAGTGTGTCGACTGCGAAACCGGAAAGGGATGTCCAGCGCTACGAGGAAAATCCTCGGGGAACATGCAAGCTAAGTACCCG
TTCCAGATGATCGCAATAGATCATAATCCTTCTCTGCCTTGGTCATTCAAAGGAAACACTTGATTTCTTCTTTGGGTTGATTTGTTCTCCGGCTACGTGA
TCGCTAAAGCTAGCTTGTCGAGGACGGCCCAAACGATCGCGGAAGGATATGTAGAATGCGTCTTCAGGCGATTTAGAGCGAGCGAATCTATTCTTCATGA
TCGCGAACCTGGGTTTAGGTCGGGTTTTTTTGCGCATTCAACCGTATTGCCGGTCAAAAGCAGCGTGCTACAATGGCATATCGGCCTCAGGCAAATGGCA
CCGCCGATCGGATGGTCCAAACGTTGACCAGGGCGCCAAAGATGTATGTCACGGACGTAAACGAACAAGGCTTGGATGAATACGCCGAGCGATTGACCTT
TGCCATCAATACGGCGCATGACCGAGTTCGGGTTGATTCTCCGTTCTATCTCATCTACGGATGGGACCCGCGATCAACTTTGGAAGCAACCCTTGCGTTG
GGATGCACCAAAACACGTGATCCTGCCCCTAGGAAATGGCGCTATCACATACAGAGACAGTTACAACGTGCCCGGGCCACCGTGAATGACCGGCTGAAGG
AAGCTATTTAGGACCGGGCTGGCCAACACAACAATGATCTAGGGCCACATGGAATAAGCTGTGGTAGCCAAGTGTTGCTTTATTTGGATTGAGTGAAAGA
AGGATATGCCAGGAAGCTGGCTCACATGTGGCATGGCTCATTCCGGGTGACCGAAAAGTGTGGAGAACATGCAGTACGGCTGGAAGTGCAGGGGACCCCA
TACCGATTGTTCCCGCACGTGCACATCTCTAAGTTCAAATTAATACGAAGTCTTCCTGAACAACCTGTTGCACGACTGGAGGTGGAAGAAACCGAGCGAG
TGAATTTTGATGAAGCTCTACTGCCGGACGGTAGTTGGAAAGGCAATTTAGCCGAAGGGGAATACTAGGTGGACAGCATTAGAGATGTGAGGTCGGTGCG
AAAAACTCGGTACGGAAGAATACACCGACAGTTCCTGGTCCAGTGAAAGGGTCGTGATGATGAAACTTGGGTGGATGAAGCAAATCTCAATTGTCGTGCG
TTGTTGCAGGAATTTAAACGTGGTCGAGCTAGACGGAATCGGTTTGAAGTGATGCAAGTACACACAAAGAAGAATCCCGATGTTAGGGTGACCAGAAGTG
CTTACCTCGACACGACGAATGGTGATCGTCTGGTTTGCGAGCGGAAAGCAACAATAACCACGCGAGCCGGCAAAGAGGAGGATTTACATGGCTAACGAAC
GTAACGATTATGGAACGAAAAACAAAGGTGAATTGAGTAGTTACGACATGCGGTCACGACTGCAGCCACAAACACAATGGTCCTTTATACCAGAAACGGC
CAATCACTTCTCTACGAACTTGTTCTTAAGGCGGTCGGTGGACGATCCCGGGTGATCAGCGATGGTTGTTCGGTATTGGCTACGCCAGGAATCTGGATAG
GTCCGTCAGGCACAAGGCGGAGTCCAAATAAAGGATGTTGGATTGTCGGCAGTCAAAACCTGGATA