Description :
From Genome Similarity Track
Location :
Scaffold_12:13692- 30685
Transcript NameFunction/comments
Phymu_g879mitochondrial-processing peptidase subunit beta
Phymu_g880kinesin heavy chain, putative
Phymu_g881conserved hypothetical protein
Phymu_g882hypothetical protein PHYSODRAFT_507752
Phymu_g883protein kinase, putative
Phymu_g884Major Facilitator Superfamily (MFS)

Sequence
16993 bases(100 bases per row)
ATGAAGACACTGCGTTCGTAGTCGATTCATTTTTCTTTTGCATTCGTTTGTGTTTCTCCCCTGTGGCAAAGTGGCGTGCGGCCCGTCCGCTTTCCCAGCA
CCTGATTATCTCGTTTTTCAGCCTCTATGCCTCATTTTCCCTTCTTGACAACGGCAGGATGCAGGGGCCACACCACACGCTTAGTATCGCAGCCAGTACG
AGCGACGACGGATGAAGTTGTAGTCCGGCAGCTCGTGGATAGGGCCCGTAGCAGCCAGGGCGTGCTCCTTGTCGTTAATGACCTCGTCAGCCGTCTtacg
gacagcagcagcatccacagCGTCAATGCGAGCAAAGATCTCGGCGGGGGTCATGCGGCGGCCGTACGTCAGCATCTGGCGACCGATGTCCTCACAGATA
GGCGACGAGCCGTCCAACTGCATCAGCATGTTCGCCTTCAGCTGCGTCTTGGCGCGCTCAACCTCCTCATCGGACGTCTTGTGCACAAGGCGCACCATCG
CCTCCATGGTGTACCACGTCAGGTCGTTCAGCTTGTACTTGTCAGCGACAGCGTACACACCGAAGAGACCGGTGTCCTGGTAGCACGTGTTGAAGGACAT
GTACGAGTgcgcgagctccttctcagcgACCACCTGACCCAGCTTGGACGACATGTTCATGCCGGCACCCGAGGTGCGGTCCCAGCTGCcgagcagcgtc
tgcatgaTCAGGAGGGGGAATGAGTGTTCGCTAGTCCAGCTGAAGCCCTcgaaggcgatggcgacGTGAGCCAGAGGCATGCTGTCGTCCTTGACGCGCA
CGTCGGATCCAACGAAACGCACGGGCTCGAGAGTGGGGGCCACGGCGGGGGTCGTGGGCAGGTCGCCGAACGACTTCTGGGCcagctccacgagctgcga
gtggtccacagcaccagcgccagcaatCACCATGCGGGGAGCCGTGTAGTGCGTGGCAATGTAGTCCTGCAGGTCCGACTTCTTGAGGTTACGGATCTAG
ACATGCATGACACAATTAGTCAAAGCAGCCAGCAGGATATCCTATAACAAGTGCCTACATTACGTACGTTCTCAATGGGTCCGAGAATGGTGCGTCCAAG
GCCGTTGCCCATGAAAGCGGTCTCGTGCAGGCGGTCGAAGACgacctcctcctgctgcttgttaacttcctccatctcgcgCAGGATGACGTCGCGTTCA
CGCTCGATGGCGGCCTCAtccagcttcgagttctGCAGGATGTCGCTGAGGATGTCCATGGCACGCggcacgtccttcttgaagacCTTAGCGTAGTACA
CAGTCTGCTCGCGGCTCGTGTAGGCGTTGAGGTGGCCGCCCAtgttctcgatctcgagctccagctgctgctgcgtgcgctTACTCGTGCCCTTGAAGGC
CATGTGCTCCAGGAAGTGGGCAGCACCGTTGTTCTGCGCGGTCTCGTAGCGGGAGCCAGCGCCGATCCACACGCCCACGGTAGCAGTCTCGCCGTGCGAG
CCCTCGGAGGCCACACGCAGGCCGCTCGgcagcgtcgtcacctcAGTGGCCGGCGCGTTAAGCACGTAGGACGGGTAGTTGGACACGGCGGCCGCCACCG
ACGACTGCGCGCGGGCGAGCGGCTGGCGCACGAGGTTCAGCTTGGACATCATCTTGCTGACTTCTGGGGGAAGGGCGGGGCGCTTGGTGCTGCGAACTTC
GCTTCCAGGCTACGAATGGGAGACCACCAGTACGCGTTGGAGACCCCACGTTTGTTTTCCTATTTTCAGCCAGGAATTCACATATTTAGACATGTGTGGG
CACAAAGACGCCTGCCACAATCGCCCCCTTTTCCTCTGAGCCCTCCGAACATTAGATATACTGAATGCAAGCTGCGGGGTTAACAACGAAGATGTGGGAT
GGGAAGTGATGCGCTGATTATTTATAATAAAGACTAAAACCCGATAGATAAGAATAAATTCAAATAAAGGTTCAAATTCTGGTGGTGTCGGGCATGGAAT
GCTACTTTCAAGTTGCGAGTCACAACTTGAGACGCCATGTCCACCGTAGATCGGAAATAGATAACAAAGCTCCGCGCAAGTTTCTTTTAATCCAGGTGCA
GTTATAGTATTATCGATCCTGGATTGAATAATCCCTACACTCTTTGCAAGTTTGCGCTGCCTACGCTCACTCTGACGTTGCAAACGATTTTTGAAATGAT
CGCACTTCAGCGTCAGGCTAAATCCACACTCCTGTCGTGATTAAGGTTTGTATCGCAGAAGCTATCGAAATGACGATCCTAGATTTTACTGGAAGTTCCA
ATCTGGAACATGAGGGTATTGCCATTCACGGCTACGTTACATCTTTCGGCGGAATGGCTGAGTGAGGTCCTCACTGAGGACACACTGTACACGTACTGTA
CAAGGATACTGGTCTTAAAGTATCTACGGCGGCATCGGCCCGTCACGAGGAGCACGGTGATAGAAGCTATAAGAGTGGATATTACCCATCAGCTATTCGG
TAGCCTAAGGTTACCTCAGGTAGGTATGGTATCGAAAGCCGGCCGCCGAGCTGCCGAAGAATTGTCAGTTGTTGTCCAGGATATGCTAGCCAGGTAGACG
ACTAACTTAGCAGCAGACAACGGTAAAGTGCAAGAACAACGGTAAAGTGCAAGTACAACAGTGAGCCTGTGTATTTGGCGACTGGTGAGGATCAGGTCAG
AATCAGACCATCATCAACTCAGTGTTGAAAAGACCATGGGATCAGCAGTGGAAACTCGCGCGGGTATCCGCGTGTGCGCGCGCTTCCGTCCGCAGAACAa
gttggagcagaagcacgagGCCGTGGAATGcgtgcagcaggaagacAATAGCGCCGTGCACGTGCACAGTGAGGCTCGCGGCGCGTCGGATGATCACACC
TTTACTTTCGATCAAGTTTTCGGCACCAAATCGTCGCAACTGGATGTGTATGAGGCGACGGCCAAGCCACTTGTGGAGTCCGCTCTGCGTGGATACAATT
GCACATGCTTCGTGTACGGCCAGACCGGATCAGGCAAGACCTTTTCCATGGAGGGAGTTCCAGGGGACAAAGATTACGAAGGAATTATCCCGCGCGTCAT
GGCCGACATTTTCGACGGTATCGAGAATATGCAGGCAGATCTTGAGTTCATCGCTCGCGTGTCGTACGTCGAAATTTATATGGAGAAAATCCGTGACCTG
CTTAAACCGTCGTCAACGAACCTGAATGTCCGCGAAAGTCGCGAGCGCGGTGTGTGGATCGCCGGAGCAACGGAGGTCTGTTGTGCATCTGCGGAAGAAA
TGCAGTCTGTTATGCGGTTGGGGGGAGCGAACCGAGTCATTTCGTCTACGAGAATGAACAACGAGTCCAGTCGAAGTCACTCCGTTTTTATCATCACAAT
TGAGCAGCGGAACACGGCGACAGGTTCGATGAAGAGTGGAAAACTCTTCCTTGTGGACTTGGCAGGATCGGAGAAAGTGGGAAAGACTCATGCTAAAGGG
CAGACGTTGAAGGAAGCACAACATATTAACAAGTCACTCAGTGCATTGGGTAGTGTGATGAACGCACTGACCAGTGGGCACGCCAACACGCACATTCCGT
ACCGCGACTCAAAGCTGACCCGGCTATTACAAGATTCACTCGGAGGTAACTCGGAAACAACTCTGCTGGTGTGTGCTAGCTCGAGTAGCTATAACAGTGA
AGAAACGATCTCCACTCTCCGATTTGGTACTCGAGCCAAGAACATCAAGAATAAGCCCAAGGTAAATGAAGAGAAAACCGTGGCAGAGTACAAGATTCTT
GTTGCTGAGAAGGACAAGCACATTGCTACGTTGGAGGCGCTTCTCCGTGAAAACAAAACTAGTGATGCCACTATACCGGTGGACACTACAGCAGAGGAAC
AGCTGAAGATATTTTCTGCAAaggtggaagagcttgaagaTGACCAGGCgtcgaaagcagcagaactctCCAGTCTCGAAGATCGGTGTGTGGAATTGGA
AGCAAAAAACAGACATCTCGAGGAAAAGCAGCGAGAGTATTCCTCACTTGTTAGTCAAAACGAAGACTttgcgaagaagctggcatTCCTAGAGAATGAT
CTTGAAGCGAAGGCCAAAGAATGTGAAGAGCTGAACCAAATGCTGGCGAGACGTCGAAAGCAGGCCTCCACCATCGATACACCTCCGTTGTCATCAGCTA
GCACAGCAGACAGCGAAGTGTCCGTACAGGCGACAATCGATGAAGACTGTGAACTGGGCCCTGAACAACTCAGTAAAATTGATGCTGCTCCTTCTACAGT
GCCTGCGGTGGAGCGTTCACGTGTTAGCAGCTCGGTACTTGACAACGAGTTGCTACGCCAACAGCTATCTGCAAAGACTCACGAGTTGAAGATCTGCACG
CAACGTGTTGACGAGCTGACGAATGAAATGGCTAAACACCGCTGTGAGTATGAGGATCAGATAGAGGCGCTGCAAGATAAACTGCGTGGATACAATATTC
ATGTGCGCGGGTTGGGAGACCAAGCTTCGCAAATTGATTCGCTGGTTGCGAACACAAAAATGCTGCGCTCCGTCCGTGGTGGAAGTCAGCCCACTCCGTT
GGCTGGCCGATCAAACTCCAATTCGCAAGACTTGAGGCTCGAAAATCAGCGCCAAAGCAGCACTGGGTCAGACAAGCTGCACGACAAGTGGGAAGTGGAC
GATGAGGTATTCCCTGTTGCACCGATCAATATGGAGTCGGTAGTTGTCAAGCGCTTGATAAGAAATATGCCGGAGCAAAGCCGAGAGAAGATATCGAAGT
GGTTGGGATTCGTGCTGGAAGGTCGCGACATTCGCTCAAACTTCCACCCAGAGATTGCAATTGCAGGAATCAGTGAGGAGGTTAACCGCGATATGAGGCG
GCTAATTGTTCCTTTACTGAAGAACCGCCATGATCTGAAGGTCCAGTCCTATGTTCGCACACGCTACATACTGGTCTCGGACTTGAAGATCACGCTCGAT
CACAAGCATAAGGACGAAGTACGTCTTGAAGCTACAGACGATTCTGCTAGTGACGATGGAACTACGGAAGgcgtgtcgtcgctgctttgGGCTAAAGGCC
ATTTATTCTACGGGCCCCGGAGTGACGCTTCCAGTCCGTCAGTGCTTCACGCAAGCCGAACGCTGGCTACGACAAAAGACCGATTCAAGTCTGTTCCTGT
GGATCTAAGTGCCAGTATCATCGAGTCAAAGTCAATGTTGGAGGCACCCCGCAGCTCCCCACAGCTTATCCGAAAGCCATCGCTTCCGTTTGATTCGTTC
AGTACGCCTGCTCCTGGATCGAGTCCAAGCAGAGGTGGAGTATTTAGTAGATTGCGTACGAAGACCGGAGTAGGGGCTATGATTGGCGATGTCAAGACAC
GCCTCAATGCCCGATACCACAAAAATCACGTCCATGAAAACGCGCTGTGCGATGGCTGCGGTATGAGTCCGATCGTTGGAGGCAAGTGGAAGTGTAACAC
GTGCGATGACGTTGAGCTGTGCGACAGCTGCTATGCTGCAGGGGTTCATGGTTTTGAGGTGAGCAACGAACTCTGTCGCcgtgtggagcagctcgccgTA
CAGAAGCATCATCTACTTGGTGAGTATCCGGAGCTCTTTGAACTGTTCCGTCGTCATATCTGCCACGACAATGTCATTCAGTTCCGAcgtgtggtgaagt
ggcttTGTGCTATTGTTTCGGGCGCTCGCTCTAAGAAAATCTACCACAAGATGATCGTGAAAAATGGTCTGCACCCGGACATTCGAGCGCGGTTAGTGGC
GCAGCTTGGGGCTTTGGCTAGTGAACGTGCCGATATTTCGCTGAAAACAGAGTGGTTTGCTGagaagacgctcgaggaagaagcagccgacTCCGACAAC
GAAGAATCTGACCCGCTGGAGTCTAGGcctgtggagctggacggGGATAAACTGTCGCCGGCGAAGACCGTCACGCCCCCAAACGTGCGGTTGGAGACAC
TGAGGATGTATCTGATGGACGCATCTGGCTCCAAGTCGGGaagtgaagttgaagcgtcCTCTGCTCTCTCGGACTTGTTAGATCCCTCAGTTAAAGTCAG
CTCCGATACTGCGCAGCCCCCAGCCTTACGACGAACCGTGAGCGCCACAGATGATTCCGCAGGGGGAGACTGTGCAGGTCCGTTGCCAGACTTGCGTCGC
CAGCAGTCGCTAGATGCGGTGAACCTGCCCACGCatggccaccagcgcgtcaAATCGGTCACCCGACTGAACATGTAAGTGCACTTTCATCCTACTATCA
GTAAGgtgcgtacatgtagtagatGTCTTCGACTGGTACAtcatgtactacatgtactgtgaTTCATGGGTGAGTGAATGGTGCATGTATCATCATGATT
CAATCCTGTGATTCACGTAGCCTCCGCATTGTGTCCATTCAATGGACTAAGAAATGGTGCCACAAATGTGACGGGCCTTCGACGCGAATCTTTGCCGTAC
CACCACTGATGGTCGAACAGTGCTGCATCCGATGCCACTCCTGGCTGCTTTTTTTCGTCATGGAGTTCATGCCTTAGCTCGAGGAATGCGTCACTTCATG
ACTCACTGACAGCGtcatttctgcttggcgcgTCAAATCATCCTCATGAATCATCGCCTTTCGTCACTGATGCGAATGCACAAATCGAAGGGCTGCTACT
TTGGAATCCAAGTTGGATGGACTCAAGGCTGATGATGGCAGCCTGTcgccagcagccagcactACCACACTCGAGTCACCAACTTACTGTGTACCGTAGT
CTCCACTGGAAACTCTACATGACAAGCACGCAGAGCACTACGGGCCGCCTACGATAAGTCATACATACCCTCCACGAAATATAAAAAAGAAACTGATACA
TTTACCAACACCCTAGCTCGCATCTCGTTTTATTCCTCCGAGATACAGAGCAATGGCGACGACGGTTTAGGAAAGAGGTGGTTGAGAGCATCACGACGGA
CGGACGCCTCGATGTCTTcagcggcaccagcaggACAGCCGACAGTCGGTGGACTGGATACGCAATGTGCTTCAAGGACTGGCCTTACTGCACTCAGCCA
CgaactcgcgctgctgcgtggagAGGCCCCACACAGGCGCACCTCGGATAAGCAACCGCTGGATCAgcgtctcttcttcgctggcgATCCGCGCCAgggc
cttcttctgctcctcggCAGCAAGTGAGGCCTTCTGCGACTCCCACTgcttcatgagctgctgcagcttggtcaGATCCTGTGGCTCGGCGCGTGCGCCA
GGGTGGAACTTGGAGTTGGCCTCGGAGCGCGTCTTGGCCGAGCCGTAGAAGCCGCCCTGGCCCTCGGAGGGCTGGCCGCCCGAGTACGTCGTGAGCGCGC
GGGCAGAGCGCACACGCCCAGCGGAGGCAGCGCGACGACAAGTGTTCAGCACGGCAGTCTGCATGATTAAAGTTCTTGGGACGCTTGGGGCGGAGCTACA
CTGCAAAAGCGGAAATGGCGAGAAAGCGGCCGTTGGCCGTCGAAGGTCGCTGACGTTGCCGCAAGATTCGTGCGCGATGGGATGTGGATGTACGCTCGCA
TAGCACCAGAATTCACGTTTTGAACACAGAAATAGGCGGTAGGCCCATCCCTTGCACATCAATTTCGGTCGGAAGGTCCTGGTTTTGCGCTATTCTAGGA
TCTCAACCAATCAACCGCGTCTGACGCGCAGGGTGTGGACCGCGTCGAATGCATCACGCCTGCGCTTGTCTCATTCCAGCCCAAATTGGGAACAAATTAA
AGAAATGAGCACTGAATCATATTTTGATGGTGCAGgtgaggagctggaaaatgggCGTCCCTTTATCTCACTCAGCGTACAACAGACTAGTGTATGTACT
TATCTTGATGGACTATTACCGATTCCCCTGACGAGTTACAGGTACTGTACGACCATTTCCTCTTCAAATGCGTCGTTGAACTTCTCGGGAGCTTTCGCAG
CTGATTTGACTTCAACatcattttctgcttgggAAACTGGGCTCAAGACCCAAAACCTGGTCAGTCCGTACCCAAATCCGCACGGAGTGATGCGTCGACA
AAGGATTGGCTTGAAGTTGCCAGCCACCCGAGTGTCATGTCCTCACCGTCGGCAGCGCAGGCCACTCCAAGCTTCTCGTGGAATTACGTGACGCCCACCG
TGCTGTCCGTCGCGCTGGCAGTACTCGTGACAGCCTGGACGTCACCCGACTGGACTTTCAagcgcgaagaaggcgtctCCGTTGAGTCCTCGACTGGCAA
tgcgtcttcatcattgGTGGGTAAGTACGAAAGCGATGTGATTAGGATCTCCACGCACCCGTTGGTGGTAGACGCAATGTCCGATGTCAAATGCCCGGAC
TTTCAACCGACCGACAAAGGTTTGAcgcacgtggagctggtgatggGGCAGGAGCAACAGCTACGAGACCGGGACCaggtcttcttcatgttaAACGGAC
AGAACGAGGGGCTTTACATGCCTTGGACGCACCAATCTACAGGTCAAGCGTGCATCTTGGAGCTGACACAGACGGCGGCGCTGAATCTCGGAGCGGATCC
GGACTTGCTAGTCAATGGGGTAAAGCTTCTCTCTGTCGATGGCTTGCCGATCCTCACGGCGGATGACTTGGATGCTCAGCGTATTGCCCACGTACTGCTG
GATGGGCAGCTCTGGGTCTGGCCTGGGGTAAAGGTGGGATACAAACGGGAGATCGAAGGCTGCATCGTTACAACGCAGTCGCTTCATCCGAAGGTGTTCA
CTGTGGAAGGTTTTTTCACtcaggaagaagcggatgcaATTATTGCTGAGGGTGTCGATCACCTCTCTCGCTCTCCAGTCGACAGCCCCGACGCAGAGGA
TGGATATCATGCGGATAGAACGAGTTTTACAGCGTTCCtggacgacagcaacttTACTAGAGACTTTCGTGCGCGGTCATCACGCCTGGCCAGGCTTCCG
TCTCCTAGTTATACCGAGAGAATGCAGCTCGTGCGATACGAAACTGGTCAATTTTTCCGCAAACACGAGGATTACTTCGACTCGAAGGAATTCATTCCGA
CCAAGCATTTCGCCGCCAATCAATTTGAGGAGTGGATTAGCTGGGCATCGTCTAAAATCAATCAATTGCGACAGGAACATGATGACAATATCATCCCAGT
GGAGTTCCTGCCAGAAGGTGAGATGCACCCCGATATTCAAAGCACTACAACGTTTCATCATGCGCTACTCAAGGGCTTCATGGAAGATACTGAGGCgagc
aacttcttctggGAACATGCCGACTTGGAGTGGAGGGATTGGATTGTTGAAAACCTTAATCGAGAAGCAGACAATATTATGGGTCCGATCCTGGAAAGCA
AAGGTTACATGCTGCCATTCATTGTGGCGTCGTGGGCGAAGCGAGCTGGCCATTCTGAGCTCGTTTATTCATTTCCGAAAGCCCCCATCAGTGGCGTTTC
CCACTACTTCAGATGGATACAATGGGCAAAGGAACGCGTGCAAACGCTAATGGATACACagccagaagctgttccaAAGCGCGTGAGACCTGAAGGTGAA
GATTACCCGACATTTTACATGAGCTTCCAGAACCGCGTGGCCGGTCATATCCTCGAAGACTATAGTCGCGATTTTCTTGTCGAGATTTTCACTGAGGATT
TCTACGCGTGGCTTGTTGAGAACAAAGATAACGATGACGttgtgctggagcttcttcgtacCAATTCCTCTGCGTTCGACCTTGTCGTAGAGTCCTGGAC
CAAGCGCGCTGGTGATCTATTCATCTACATGAAGCCAAAGTATCTGCGTCATTTCGAACCGAATCGCTTTGCGACGCTGTTCCTGTATCTAAACGATTGT
CCTGAAGGTGGCGAGACAGTTTTCCCATATTCGAAGGAGCGACTGGTGACTGGAATCAAGCGGGAGGGTATGGAAGAGTGCTCCGACGGTCTTGCAGTGC
CGCCTGTGAAGCTTACGGCGTCGTTATTTTACTCTCAGACGCCAGTGAATGACTTGGATCCAGCAAGTCTACACGGCGGTTGCCCACCAGCAAAAGGTGT
CAAATGTACGTCTGTATAATTCTGTATCTTGTGCTGAAAACTTCAACTAACCAACTAATTCCTTTGCTGTAGTCGGAGCGAACTCCTTCATGTGGAATGC
TGATGCGGACGAGGGCGCAAACGCTTGGGGCATGGGCGAAGACTTTAAATCGATGTCAACAGTATCGCAACAATAAtaatacttgaagtataaAAACTTC
ATAAATACGATACAAATTCCTGCGTCAAGTCTATAAAAGGCGACCAAGACAACAGAAGACACCGCTCAATTCGACACGATGGGCCATACAGCTAGCGTTA
ATCGGCTGCGACGTGGCTCGACAGGCACGCTGTATGGAGAGCCCGCAGGTGCatcagcagcgccacgtggGAGCTATACGCCTGCGCAGATGCAGGCTCT
GTATTTGAGTCGAGGAAGGCCTGACATGGCCTTCATGTCGAACCAGGGCCGCGCGCCAGTCGACGTCCCCGAGCTACAGCAGACGTGTACGGTGAAGAAT
CACGTGAACCTTAAGAAGACCAgtctcaagctgcagcagtcgcccACAGAGGGACAGCTGTACGCTCTGGAATTCCAGTTTGACGCCACCAAACCATGCG
ACATCAGTGTCTATTTGGTGGCATCAGAgaccgtcgacgccgacAGTGGCGGGTCCAGCTTTGCACTGGTTCATGCAGACAAGAACCCGATACTGACTCG
GCATTTCAAGGCAGGCTTAGGACAGACCTTCGTTCTTAACGGAGGCGAGAAGAATGAGACCACTGCGGATACTGAGGAAGGGAATCACGAGGAGCTCTTA
CCACTCTTGGACTTCTCGCCATACAGTCCGGATGAACTGGTGTACAAGCCCGGCACGACGCAGTTTCCGTTGATCGTTGTGCTTGAAGTATCTTCACCCA
GTGAGTGCGCATTGAACCATTTCATCGACCTTTTCTTCTGCTTATTGAATGTTGCGTTTGTTGATAGGGAAAGGCCCGCAATCTCAGTCGACGTTCTGCA
CATTCGTCAAGAAAGGAGAAGGACTGTGGGATATCAAGATGCTTAAGCAGAAAATCTTGGCAAGAATAGTTGTCTGGGCACCATCAGAAATGCTAGAGCT
GACGTTTGTGTCTGTTTCACTTGTTTAGGTCGAAGGGTTGACGTACGAGTTGCAGGAGATCTACGGCATTGATGGATCAGTGGCGGCAGCACCGAAGACT
GAGAGGAATGGTGCAGCCGGAGACGACCAAGCTAGCACGACACAGACAGCCAAAGAAGAGATTGAAATCCctgaaggtgctgagtgCATTATCTGCTTGT
GTGAACCGCGTAACACTACAGTTCTTCCCTGCCGGCACATGTGCCTCTGCAGCGAGTGCGCTGAAGCATTACGCAAGAGCTCTAGCACGTGTCCTATTTG
TCGGACACCCGTTGAGGCATTGCTTCAGATCCGAGTCGAGGCAAAGGAGACCACGACGacagaagcagaggaagacaagactgaagtggaagacgtCAAG
TGATAAAAATTGGACCAAGCGACTGACAAgaacaaaaaaaaactataCTTTGCCAATTATGCACTTTGAAGTTCGTCTGTACTGTGAATACCTAGTTTCC
TTTCAACATGATATTACAGAAGTATTGTAATACCTCATCGAGCTGTACAATCGGAAGCATAACGAAAGAATTTATCAAATTACTGGTTCCTTCCTACCTC
ATCCTTGTCCTTTCGATGCGTGACGGACCACCAGAATCAAAAGTTACCCCTCGGCTTTCGATTTGTCCAGTCCTTCAACGCATCGAAAAGATTCTCTATC
CGTGCagacttcgtcttcgctaGTGACACGTTGCCGCGCACAGTCCTGTAGCTGCCTGGGATCCGCGCGCTTGATTTTTCTTGTTCGTTTTTGGTTGATT
ATCTTGTACAAATACTGGCGGCGCCTGACAGTGCGTGTTTGGCGGTGAAAAGACCCGACAAAAAGGGTTTGTTCGCAAAGCTTCCGCCCTTCATTGTCGA
TTAGTTACACCAAAACACATGCAGATAATACGTTACTGTCGCACCGCATCCCCTCCGCTGCCCTTGCCTGTGCTCGTGCTCCGTCCCGCAGACTATTAAG
TCGATGCCATTCTCGTTAGGTCCCAAGCTCTTGGGGCTGCCTAACACCAGCTAATTGTTCTTCCTCCACATTCCCTTCATCTGCCAACGTTCAAAACAAC
AAAGTCAATTAGAGAAATCAAAACGATAGCGCACTCACCAAGTTCGGACCTTTTTCATAGATAAACGACTTACCAAGTTGGCGACTTGTTCGGGGGCGTC
GCGAAGTCGGTTGGCCGTCGACGGAGTCGAGCTGACATCACCCGGTGAGCCGTAGTAAGGGCTGCCCTGGCCTTTGGCAGGATAACCCCGCTGAGATCTT
GTCTGCTGAACTTCCTCTGCAGCGACTTTTGCATTCAGGTCACCTGACGACTGCGACTGCATATCAGCTAGGTTTGGCTGCCGTCCACCACGCCCGGGTG
GACTGCCACCGTTGTTGTCTCCCCGTCGGCTAGGGCTTTCACCTCCGTGGCTAAAGTTGTTGTCTGCGCTGGAATTTGAGTCATCCGAAGTCGTAGGAGA
TCCGACCTTAGCCGCGTTGTACGACAGTTTGCGCGTCATCATTTCTACCATTTGCTCCCGCTTCTTTAGTTCACTTTCGCGTCGCATGTaatccacctcc
agctctgcgacggaaaaaaaaaatgtaaGACTCCGTCCGCATCATTTGAAATATCAGCTGAACATAcctttcagcttcttctcccgAGCCATCAAGGCCG
CCTCCTGTCGACGAAGGTCCTCTTCAATGCCCAATAGCTCCTTCATTTTCTGATTGTAGGATGTCTGCAGGTTCTGATCGGCAGCCGGTTGCGGGGCGTT
GGCCGCTGTGTATGCACGTAATCTCTGTTGCAGCTGCGGAACACGCTCCAAATCTTCAATTCTCGGTCGTCGAGAGCGTTGTCTGTGGAGCATCCATCGA
ATGACCTGGAAAAGGCCCTCCGAGTACTGCGACGGGATACGCGTGAACTTGCCTGCGTTAATCTTTTTTGCCAGTGCAAGCTGGTTCGTCGCATCGAAAG
GAGGGCcgagtgtagccatctcgtACAGCAAACATCCGAGCGCCCAAATGTCGGAACGGTCGTCGTAAGTCATCTCGTTCACCATCTCCGGACTCATGTA
GTAAGGGGTTCCGACATTCGTCTGGGCAAAACGAGACtcgctgctgagctcttTGGCGAGTCCGAAGTCACCAAGCTTGGCATTGTTCTGGAGAGAGAAA
TAAAGGAAAACCTGTCAGAAAGCCATACACAGCTACGAAAAAGACAAGGAAAAACACCATCGTACGTTGGAGTCTAAGAAAATGTTGCCAGGCTTGATGT
CACGGTGGAGAATGGGACGGATGGCGTTGCCTTCGCGGTGACGGTGGCACTCCTTCAGTGCCAGGAAAATGTGCGTGAAAATGTGCCAGATAAAGCCCTC
TTCGATGTAGGACCTATAGACAAAAAACAATTCACCCCAAAAAGTCAGAAATCTATCAGAGATTCCGAATTGATACAAGATGCTTCTCTTGGGATAGGCA
TCGACTGTGGCGTACCCCTCCCGTTTCTTCCTCTTGATAAACTGTCCGAGGTCACCACCCTCGCAGTATTCCATGACGATGTAGATCTTGGTGGCCTGCT
TGTCGATCACACGGTCCAGGTAACGGACGATGTGCGGGTGGCGCAACTCCCTAAGGATGTTCACCTGTAGCACACAGAATAAAGTCAGAAGGTCCACCCT
TGAactcccagcagcagctctagaCGTTTACGCACCTCGGACACAAtaagctgcttctccttctcgctcatGGCGCCGTAGTTCACTTCCTTCCACACGA
GCATCTGCTCAATTAAGCACAAGTTAGTACACATTCGCACTGTTGGTACAGAACCTGGAGCTCACCTTGCGGTCGGCCTTGCGCACGATCTGCGTAACGA
CGCCGAACGAGCCCTTGCCGATGATGCGGACCTGCTCGTACGCGTCCATGTTGGGCTAGCTGGAGCTGTGCGGTGGGGAGAGGGGGGGTCTCTGGATAGG
AGACAAGAGAGGGGGAAATTGTTCCTGTAACGCGAGAGACTGAGGCGAGTTCGcggcgaggaggagcgacTGTCGTAGTGACCGGTCGACCCAAACGCTG
CAGGACTTCTCTCCTCTCCGCTGTTCTTCGGTTTGTGGCCTGCTCCTTGCAATTTATCGCCACAGCAAACGCCAGCCAAACTCTCCCCCTTTTTGTGTAT
TCCGGGTAGTCAAATTACCCTCCCCTTTTCCACGCCACATACTAAAATCAAGTCTGCTAGGAATCTTGGCAAATAGGTCCTATCCGTCATATGGCTAAAT
TTCTAGAGAAACAATTCTAGGTTCACAGAAAGCGAGGCTTCCACGCATCTTACAAACCACCAGGATGCATGTTGCGGTACACTTGAGCTCAAAAAGATAA
AGATTTAGTGGTCATTTCGAATGACCCAGCGTTTCCTGTCGTTTCAGACGGTCTGTTTACGACGCCACACTGGCACTGTACTGCCCGTGTCTGTTCGATT
TGACTACCCAGATGCATTTTCCGGTATAGGCAAGTCAGATCAAAAAGCCAGCCCCGCGTGGCCAGGCAGTATCGTGCAAGAGCCCACACACCAGAGGCGG
AAAGAAAGTCGAGGTCGCTCCTCGTGCAATGCTTTTCAGGGCGTCGTGCCTGCTTACGATCGCTGCTTCACGCTCTGAGCACATACACATCTGTCAGTTC
GAAGACgattattatttttttttatctttGGCTCAAGGTTGAAGATGATAACACAGCAGTACCAGTATGCtgaatggctacatgtacagtccTCCTGCCG
TTTTTTTAGTGCTCCGCAGCCAGTAACGCCTCCTggtccagcgcgtcctcgtccagcattAGCGAGATCCTTCGCTTCTTGGCATTCGTGTGGTTTAGGA
TGGATCCGTTCTGGTAGTCCACCACGTTCAAGGCGATGCCCACGAGGCTGCCCAGCACGCCGAACGATACGAACAACAGCTCAACCCCCGGAATGTACCG
GTCGTCGTGGTTGAATTCGGCGGCAACTGCCAGTGGGAACAGCGCAAGCCCGATGTTCTGGAAAGATATGCTGGTTAGATTCTACAAGTGCCAAAGCTAT
CGCCAATAAAAAATTAGCCGCACCTGAATGGCAGTGATCGCTCCGTACGCGGTTCCAACATGCTTTGCCTCGACCACGTCTGCAAAGGCAAGATACACAG
TTAGACAGCCTTAAAAGCTGACAAAAACCTCCGCACAAACTTACATGGAACAGAAGGCCATAATGCTGCTGCAAACACGCTGTAGGCGAGGCCTTGAAGT
ACCAGCGGCACATAAAGAGACACTTGAGTCAATCCAAGCATGACGTGGACTGCTGTCAGTGCCAGTGGTGCCACCAGTGCCAAAAAAGCTCGAAGACCGA
TCCGATCCACCACAAACCCGAGGAACGGAGAGATAACAGCACTGATAATGTACGGGATGGACATGGGGGTAgcggccttcttggccgcgtcGGTTTTCAT
GGCACAGTAAATCCGTGTCAGCGGTCCAAATTGCCaagcttcgtcgtcacaATTGATCTTGTCGCCAAGAATCAGCGGAGGTGAAGTGGAGCAGTTCCAC
TGGTCCAGCGGCTCTTTAATGGTGCAGTTTGCCGACAGCAAAGGGAGGGGCCACCCGTAGGGAGGAGCGTTGGGGCATCCCGGGACGATTTCTCGGCAAT
CGATTTCAAAACTATAGAAACCCTCTCCACATCTACGGCAAGACTCAGGGGGCTCCTTGAAGAAATCACGCTCCATTAAGAGGCTGCTGGCGACGTTGTT
GAAGGGAATGACACAGCCGTAGACTACCAGGCAACTCAGCGCCAATAGCCAAAAGGCGGGACGGAAATGCTTCACGTCACTGAAGTGGATGCTCTCCGCT
GCCACGACCCCCTCTTTCTGATTCTCTTTCGTCATTTTTTCAGCTCGTTTATCGATAGGAATTACCAGTAGCACGGTGAACGCGGAGGCGAGACACATGA
TGACACCCACCCAGAGCGCTGCCGAGACATTTGACGCTTCAGCGACAATCGGACTGAGCTCGTTGTTGATGACACTCCCCAGTCGAGCCACACTAAGATT
GATGCCCAAAGCGAGTGCAAGCTCACTGTTTTTGAACCACGACGCGACGAGCGTTCCCTGTGCCACACCCAAACTTTCTCCACCGAAACCAAACACAACT
CGACCAAACTGCAATAAGAGTTAAACACAAACGTCAGTCCTCGTGTATAGATGGCCAACGCAGGAGAACATCGATCACTTTACCAGCATCATGTTAAAGC
TAGAGAGCGAACAGCCTGTTGCAAAGATCAATTGTCCTGCTAAGATCGCCATCGAGAAGGCGAAAAGCATCACCCGCGCGCCGAAACGATCGACCAATAC
ACCGCCGAAGAATGGCAACAGGATATTGGGGATCGAGTACAACGTGTACAACAGGTTCTACAGTCAAAAACGAGTCCCAATAGTTATTATCTGCCATTTG
CAACACAGTTATCTTCTGTTGTGGCGAACGTACGAACAAAAACTCATAGCGATCCTTCGGGATGTTgctgaagtgctgctggagctggctcTTGAGCGCC
GCAGGGTTGTCAAAGCAGTAGTAGTTGCCGATCATCAACACACacgacaggaacagcaccAACCAGCGCACGCGCAGCTCGCTCTTGTCCGCCATGGCTG
CTCACAATTCTTTTCGGGGGAAAGGATGTGGATACAAAGTCTGAGTCTGAGTCAGACTCAGATGAGATGAGATGAATATTCACATAAGTACGA