Description :
From Genome Similarity Track
Location :
Scaffold_72:136895- 142043
Transcript NameFunction/comments
Hyaar_Emoy2807993serine protease family S01A, putative
Hyaar_Emoy2807994serine protease family S01A, putative

Sequence
5148 bases(100 bases per row)
TGGTTTTGTGACTTTTGGACATTTATGGTACTGATAATGAGATTTGCTCGTGAGCTACCTAAAGATTATCTGAAGGAGCGGGTACGAAGCATTACCGTGG
ATTCGCTACACCATTCCCAGCACAACGCAGCACCTACGCATATCTTGTATGTGCACCTCAAACCGGTCAATGATTGATTTAAATCAAGCTGCAGTATGCT
TTAGGATGCATGGGCCTCACAAAATACAAGGCAGGATGGCACCATTTCGTAGGTAGAATGCTGGAAAGAAACAGTGTGAACACATGAAGAACGTTTCCCA
GGACTGAATGTTCGAGGTATGCTCATGTGAAAGAGTACACGAGTGGACGGTACTTTGTCTTGATCAGAGGCGTTACAGATTTTGTGCGCATAGCTCGCGA
ATGATATCAGCAGGTATTCAGGTACAATGTTTAAGCATTATTTTCTCACGAGCACTTATTTAAGTTTGATCCTGACGCTACCAATTGCAGCCACACGAGC
CAACCTGACGTTTCCCGATTTTTTTGCAGGTGATAGCTCTGTTGTACCATGTAGCTGTTTGCAAACGCCGATGGAGCGAAGGCACGTTCACTATGTGTGT
CGTAGTGCCCATACGCTCCTTTGGAGGTACTGGAGCTATATTTGGAAATGGTACTAGTATTAGGAAACTACGCTCGAGGAGGTACTGGTACTGGTAAAAG
CTCTTATGAAAACCTAGACACGAACATGGCAGGCAGTGAGGTACCTTGCGCTTCATCGACTGCTGTACTGATTGCCTGAAATAGCTCATAGCTGATGTCT
AGCAGCTATGAGCTGGCTTTCAGTGGCCAGATTCAGGCTTGCATCGACTGCATGTCGGTGATGAGCCCCGTTAATAGAAACACAATATCGATTTACTTAG
TCGTATAGAGCTTGCCATCTCCACAACTAACATTCGTGACGATGCCGTCGACGTTAAACGCGTGACAGTAGACTTCGGCTACTTTACATATCTTGAAACA
GAAACTGATTTAACTTTGGGTCAAAAAGCGGATGCATCGATACATAGAAGTCCTAAGGCTAGCTAATGACAATACGTTGTAATGCACTCGCATAGTGCTT
TCGCATCGTAACAATAGCGAAAAATTGCAACAAGCAAGTACTGGCCAAAGTCGACGGCTTGAGCACATTGGAGATGCCGTTGTGGCTTTCCTTGTAATAG
ATAGATCATGTTTGTGTAACGAGAATTTTTTGTAGGTATCACGATAGGTGCTACCAGGGACTTTTCAGTGATAGTCAGAGCTTAATTTGTTGCAAGTAGA
CTATTCAAACGGATGCTTTCTCTAGACCTGTAAACGAAAACGAGTGACATTCGTACGTGTGCAGATAGATTCAAAGTCATGCCTACGTAGAAATGTGGTA
GCCTTATGACATATCACGAGCTATATCTCGACGATAGACTTGCTTGGCACAAATAGGATCGGCGCGCTTCACTGACGACGCAGTATCTCACGCACTTTAA
CTTATCCTGCGCTGCTATTGTAAATTGACTCAGGAAACCGTGGCGAACGCGAGCTATCTAGAAGATATCTAACTTATAAGAAAGAACGTAACAATAGCCA
CTTACAGTATGCATCTTTTCGTGTTATCTCTCATACTAGCGCACGAGAGAATCGAAATATCTGCAACCGTCGTACGACAGTACAAAGCTGTCGTGGCTCA
TTTCACCACGCAACAGAGCTCGACAATATCGACCCGTTTCGCAAACAATGGCCCTTCGTGACTGCGCCAACGTCGCTTGTAGTCAAAGCCTTCGCACCAG
TCTCCTTCTAGTTTAATCTGTCAAATGCAACCGTACGTTCCTTCGCAGCTGAGGTCCGCCCATTACTAGAGGACTCGGCGATCGACGCAATCGCATCGAC
AGACTCCGTAGTCATCGTCTTCGAGGACTTGCTACCTGGAGTCGCCATGACTTCTAGTTCTTTTGTTTTCGACGCATTGTCTACTTGCGATGTCTCGTCT
CGATCTTTCCGATCTCCACTCTCCACAACATTGTTAATGTAGTCCAATACAGACGACACGCGAGTGTAAACACCAGGTTCCTTTCCGCAATGATCACCTG
TCCAGCTCACAAACCCGACAAGTACATCATTAACGATAAGCGGTCCGCCAGCGTCACCCCTACAAGAGCTCTTGCCTTTGCCTTTACCGGCACAAATCAT
TCCTTCTGTAAGTCGATCCGTGTACGACTCAAATTGACTGCACTCTGCCTTCGAGATGATAGGAATGTCCACTTGTTGAAGAGTGAAGCTAGCAGAGCTC
TCTTCAGTCTGCCCCCAGCCAAGTACCGTAGCAATGGTGCCAACTTTCTCGTCCGATCCGTCAGCTGCAGGCAAAGTCGCCACCTTGTGCGTCATCGCTG
TCTCAAGGCGAAAGAGCCCCACGTCAAACAAGTGCTTCCTCTTGTTGTACATCGGGTGCTTGAACCCTTCAAGAATCTTGACGGTCTCCCCATCCTCTCC
GAAACTATACTCCGTATCAAACGAAGCCGTCATTTCAACTTCGTCCGTCTTGATACAGTGAGCTGTTGTCACGAGGTACCGTGGAGCAATCAACGTGGCC
GCACAAACGGTCACGCCGTCAATCCGGATACTTGCCATGTAGGGGTAATTGTCAATATCGGCATCGAATCCACCAATAATGCGACTCTCTTCGTCCGCCG
TCAAGCCTGTGCTTTCCAAAACAGGTTTATCTTCTGCTATGTCTTTGACAGTCGTGAACGAAAAGTCTTTTGCATTGGCGGTCAAAGTAGAGGACACAAG
AACGACCACCTCGAGATATTTCAGCATTTTCACCGCTTAGAAACGTCACCTTGTGCTTCACTGAACGCAAAAGCAGTAATGCGGGGCAGACTAACCACTT
GTTTGCGATACGGTCATCAGCTGTGGTTTAGAGCTCCACAAACTGAAGACGGTGACTGGACAGAAGGTTTAACGGACCAATCAGGCGACGAAGTAGCGAA
AAACAGCTGGGAAAAGAACAAGATGGGAACGCACGACGTCAGGGACGGTGGTACAATCGAGTCGCTGCGGTTTATTCCGCTCCATACTGAAGTTAGGTTT
GAACTAGGGGAGGAGTGTAGTGTCGTCTCGAGCTATATCTGAAACCATGCATGTCTTTCGTAGCGTGTCAATACAAAAGCTGTATACCATCAAACGATCG
CGACGTGGGTGTTTACAACACACATCTACAGTCGTGCGTTTTCGGGCCTTATTCAACAGGATCAGCATCGTCCTCTTCACTTTCTTCACCATTCTCGGTC
TCCTCCTCTTCTTCATCCTGCTTCTTCTTGGTCTCCGGTTTGGCTGCTTTCTTTGTTGGAGCTAACGTTTCGTCCTCTTCATCTTCGTCTTCCTCTTCAC
TCACAGGCTTCTTTGCTGCCTTCTTTGTCGTTTTTGGAGCTGCTGTCGCTTCCTCGCTCTCCTCCTCCTCCTCCTCCTCCTCTTCACTCACAGGCTTCTT
TGCTGCCTTCTTTATCGTCTTTGGAGATGCTGTCGCTTCCTCGCTCTCCTCCTCCTCTTCACTCACAGGCTTCTTTGCTGCCTTCTTTATCGTCTTTGGA
GATGCTGTCGCTTCCTCGCTCTCCTCCTCCTCTTCACTCACAGGCTTCTTTTGCTGCCTTCTTTATCGTCTTTGGAGCTGCAGTCGCTTCCTCCTCCTCA
TCTTCCTCTTCGTCGTCTCCTTCTTGCTCTTCAGACTTGCCCTTGGTCGGCGACTTCGTTGACGTCTTCGACGAGGCCTCGACATCGTCGTCAGCATCGT
TCTCATCAGCAGACCAGGTCTCCTTTGACGATGTCGTCGACGTCTTAGCAGCCTTAGCCTCCTCTTCATCTTCTCCCTTCTTCACTAGATGTTCAAATTC
CTCTTCTGCCTCCTCTTCTTCCNNNNNNNNNNNNTCTTCCAACTCCTTGTCTACCGCAATCATCTTTTTCGCCTTCTTTTCTTGCCTCTTCGCTGCAGCC
TTCACTAGCACGGCATCTTGCACCTCTTCTTCATCGCTGCCCGCTACCCCTTCTTTGAGCGCATTGTCAGCTGCAGCCTCTAGCTTCTCAGCCTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCGGTTGACGCCTTGGACTTCTTGCTGGGCTCAGCCTCCTCTTCGTCTTCATCTTCGT
CTTCTCCCTTTGCCAGCTTTTCAATTTCTTCCTCCACTTCCTCTTCTTCCAGATCCTCTTCCAGCTCCTTGTCTAACGCAATCACCTTTTTCGCCTTCTT
TTCTTCTTCCTTCGCGACAGCCTTGACCTGCTTGGCATCCTCCACCTCTTCTTCATCGCTGTCCGCTACCCCTTCTTCCAGCGCTTTGTCAGCATCAGCC
TCTAGCTTCTCGGCCGCTTTTTTAGCGAGCCGGGCAGCCTTCATATCTTCCTTCACATTTTCTTCAATGTCTGACAGCCGTCGACGACCACGACGAACCT
TGCAGCGTGATGATGTAGCAGACGCCACTGATGCGACAGAAGATCCCCCCGTCGGCGTGTCGGCAGATTCGACCGTAGTCAGAGCAGAAGATGTCGGTTC
CTCCAATGAACGGGACGACAAAGTGCTGTCCATATTGTCACTTAAAACACCATTGATGAACTCCATCACGGAAGTGAGACGCATGAACACGCCAGCACTA
ACCCCGCACTTGCCACCCCAGCTCACAAATCCAATCAAAGTGCCGTTTTTAGTCACCAACGGACCACCCGAGTCCCCATTGCACGAGTCCTTGCCACCTC
CATTTCCTGCACACATCATACTCTCGGTAATGCGGTTGTTGTACAATTTGTTGCACTCGGCATTAGAAATGACCCCGAGATTCACTCGTTGGAGCGTCTT
GCTCACCGATCCGTTCTCAGTCTTCCCCCATCCAAGAACGGTCCCTTCCGTGCCAACCTCATTGTCCGAGCCATCTACTGCACATAATTTCGCCGGCTTG
TGCTTGGACGGCGTCTCGAGCTTCATCAGCCCCACATCATATAAATGGGTCTTCCCAACGTACATCGGGTGTCGAAATTCAGCAACAACTTCAATCTTCT
CCTCACCCGGAGTTGGCCCAGCGCCAAGTGCTGTACCAAGGTGGGCAA