Description :
From Genome Similarity Track
Location :
scaffold_8:1368815- 1370291
Sequence
1476 bases(100 bases per row)
gtctccacagacaaatcaCCGTTAggtgttcaaacgctgctcggcagctcggagctctgcctctcgtcctcagcatagccgagatccattggctcaggct
cgctcgacgagctctgagggtgtgcattccaaataAGTCGTGCCGGCctgaagttgaatttggcattcaaaacCAcgttcactgcttcttcaaaagaaga
cggatgcacacaaaAGGCTTCCGTTCTGACCATGCCAGTGCGAAGGTCCTCCATATAGACGGTCAATGCGACCGTCTCAGGGAAAAAATTTGctgtcatc
ccggcaataagagttctcaactcttggacagagCCCATTGACTTCTTCGAGCCCTGTCGatcggcaaggaaacgtgatCACACGCGACATGCCTGCTTCG
GCGGCTAGAgtactcgcaaaagctgacgcttcagctctttcCAAGAGGGAATGCAGTTTCAACCGAAGTATTGCAcattagtgcccattctcgcgctcgg
cccccgagcttggagatagctagcgccacgcgctgttgcttgttttggagcatggcgaatgccatagccatctcggcatctctcatccagagcagacAAT
TCTCGCTATCTTTTCTCTCGAAAGTCttgacgctcaccatgagcggcctggatTGGAAGTAATCATCTGTCGTAGACGGtggtgtcatagacgcagtccg
cgctgacagcttctgctgtaagttctCCTCTAATAGAGTATTTataaacgcctctaggcgcgcgcttatggcctccggcccttgcgcaacaaggtgctcc
acgccctcatgGCCTGACAGGgatatcagcttattaagctcatcctgcatgccttggggcaaataggactGTTCATTTTTCTCACAGaatatcagtcgta
acgactcaggcgtagattgactatgagtgctaccaagtgcagcgggactgccgtagctctttgcttagctaaggtcaccggccttacgttctttccaata
accagtacgagtgtagcggttcgcaatccgctaccttcaatatttttaagcttaaccaaggtaagaCGCTCTTTCGTTAAAAATTGAAACCGTATTTTAA
TGTTTTAGTTGTGGCGGAGCCGtcaaccctaggttttcctaatgaatatagtaatacctaattaatatagtaaaaccattaatatgcattactggTAATC
ctaccacgtggtggcttcttgttacggtgtagccacaccacagtgtgattacatcaacttgtgtaatccacacttaTGGACCGCCGCACCGACCCgttcc
tttcatacaagggtatgtgtaaccttATTACAGCTGGCCCCCGCATTGCGCTCTACAAGTAAACAAATATCATTCAGTGCTAGTTCAAACAGTATGCAAA
TTTGAGCAAATATATTGAAAAATACTTGAAGAGCTCTGGGCTCCGCGTTCTAAGGACAGTCTACAGTTTATCCTCT