Description :
From Genome Similarity Track
Location :
Scaffold_8:136867- 141493
Transcript NameFunction/comments
Physo_129515hypothetical protein
Physo_129516reverse transcriptase
Physo_129517reverse transcriptase

Sequence
4626 bases(100 bases per row)
GGTTGTTGCGATCTGGATCTTTGGCTGGATCCCATGTTCGCCCGCTTCCCCCAGCAGAGTGAGGACACCACGTGGTTCACTGGTGGAGAGGCCATTGCAG
CGGGGCGTGCGGCACCCGCAGATCTGGTGGACGCTCTGGCCGACTGCGACCGCGCTGACCCATGGCGTAACCACTTCCGCACCTCTGCCGGCTCGCACCC
TGCACTCCGCATTGACCGCCTTCGCCTAAAATTCTCTCGTGCCTAGTGGTGGTGCAGCGATTCCGCGGGACTTCTCCCTCTGGCGTCTAGTTCAAGCGTG
TTTGGTAGCGGTGTAAGGTGGCTAGTCGTTTTGACTGCATGTCTTAATTCAACTTCAGTTTCATCACTCGCAGTCCTCCTCATCTTTTCGTCCACAATCC
AGATCCATTTCATCAGTCGTCATTCCGTTCACTTGTTCATCACATATACATGTACCCCAAGTCTTCCACAGAAATGCAGCCTCCCTGCCCATCTTTCTCC
GCTAGTTTTATCTCATGACGGCCTGCCCGTCTGAGAGCGCCCTTCCTCCTTGATGCTGCAGCCGTCCTGCAGATCCTTCACTTTGATCTTCACGTCGGTG
CCCAGCCCACCTGCGTGGCTGCCTCCGTCACTCTTCCTCGTGTGACTACATGGCTTGGAATCGATTCCGTTTCGCATGGGCGGTCAGAAAGTCGTGGATC
AGCGCGCCGCAGTTCAAGTCCGCCTCATCCACCCACGAGAGCTCTTCGTATCCTTTCCACCTGATCTGAAATTCGCGCAACGTACGTCCATAGCGCGTCT
TTCGTCCAGTCCTCACGTCCAAGATCTGCTCCACTTCAAACTCGTCTTCTCCCAGCTCTCGATCCCAGCTGTCTTCTGGCAGCAGGGCTTCATCGAAGTC
TACTCGATCGGCCTCGTCAACAGTTAACTGGATCCGCGGGCGTTCGGGAAACTCTCTCATCAGCTTCCGTTTGGCAATATGTACCACCGGAAAGAGGTGG
TACTCAGTCCCTGCAGTTTCCAACCGCACCGTATACTCGTTCACCATCTCTAGCACTCGGAAAGGCCCGTGCCACATGTGCGCGAGCTTCTTGGCATAGC
CCTCCTTCACTCCATCCAGATAGAGCGATACGCGTGATCCAGCTTTAATATGGTGGGGTGTAGCCTGCTCGTTTCGCGCTTCCGCCCTTTCAGCGATTGC
CTTCTTCAACTTCTCGTTCACCTCTTGCCTGGCAAGTTGGTAGAACTTCTGGATCCTGTACCGCCAGCGGCGGGGATTCGAGTCTCGTCTCTTGGTGCTG
CCTACGGGCAACGTTGCTTCCAAAGTAGTCGTAGGATCCCAACCATGCGCTAGATAAAAAGGCGTATCGCCCCTGATCCGGTCATGAGCCGTGTTCAGTG
CGAACATTAGCCGTTCCGCGTACTCATCCCCGTCGCGCTGATCTTCATCTTGGACATACATCTTGATAGCCCTCGTGATAGTCTGCACCATTCGCTCCGC
GGTTCCATTTGATTGTGGCCGGTAGGCCATAGTGGCCCGCTGGCGCTGACCTAAGATGCGGTTGAAGGCGCGAAAGAAATCCGACATAAACCCGGGCTCA
CGATCGTGACGGATCACCTCGCTCGCACCGAAGCGGCGGAAAACACACTCCTTGTAAGACTCAGCAATCGTCTGCGCAGTACGCGATCCACTGGCCTTCG
CCACCACATAGCCTGTGAACAGATCCACCCAGATGAGTAGTTCGGTGTTGCCCTTCTTTGACTTCGGGAGCGACGGGGTATGATCCATCGCGATCACCTG
GAACGGATACGTCGCTCGGATGTTCCCTGGGGACCTTCCTCGGATCGTCGGTCGCCCCTTGCCTGTCTCGCAGTCGACACATTCACCGACAAACTGCTGC
ACCGACCTAAACATCCCCCTCCAGAAGAAGTGAGGTTTGATCCGTTGATAGGTCCGACTGATCCCTTGGTGCTCCCCTTCCAGGCTCACATGGTAGTGGT
GGAGTAGGTCAGGTTGTAGAGATTCCGGCACGACTAGTCGAAGCAGGCCGTCCCGGTCCGCCTCTGTTCTTGCCGACGGCGCGCAATAGTACAGCAGCCC
TTGGGTATCCGTTTCGAAGTCTGCCGCTAACAGGCTGCAAGCCTTTGCCTCCGCCTGCGACATTGCCTGTACATTCCCTTGTAAGTATTGCTTCAGCTGC
TGGATCCATGCCTCTTCTTCCTGGGCCTGGCGGATCCGTTCTACACGTAACTGTTGCACCACTTCCTCTTCCAACACCTTCGCCTTCGCATTCCTTCCGG
CACTGGATCGAGTGTGCATAGCATCAACTTGGACCACGTCACCCGCTGTAGCCGGCATCAGCACTTCCTCCAGTCGGTTCAGCGTGATCAAGTCTTCCGC
TTCCGCGTCTGTCTCCACAGTTCTCCCTTCTTCCCGTTGTAGAGCGGCGCCGGCCAAACTGTCCGCACTCGCGTTCCATGCTCTCTTCACGTGTAACAGG
TCGTGGGTCGGCCACTTGCGCAGACATTCTAGTGCCTTCTGCCTCGAAAGCATGAGACTCGGCGCTTTGCAGTCAATCTCCCCACGCATCTGACGGATCA
CCAGGTTGGAGTCACCGCATACTATCAGACGTCGCAGCTCTAGCCCTTGTAGCAATTTGAAGCAGAGTAGCAGTCCATGATATTCCGCCTCATTCACGGT
CATGTCGGCCGCATATCTCGATGCTGCGGCGACTACCGTCCACTCGGGCAACTTTCACACGATCGCACTGAAGGCTCCCCCACCCCTTTTCACTCTGGCG
GATCCATCGAAACTTGCCACCCATAACTCTTCCTCAAGCTCCACTGTAGGGACTGGCATGGATATCACCTTCCGTGGTTCCTTCCTGGGGGCGATTGCTG
CTAGTGCCTCATCCATCTTCTCTCTAGGGGTGATGCAAGCTGCTAGCGCCCCTAGGATCTCGTCCTCGCCCTTGGCGCATCGCTCAATTTCGATCATCCA
TGTCGACAACAACGTAGCCCATTGGCTCAGGCTGCCTTGCAGCCCCGTCGACCTGAACAACCAGGCCAGCGTGGAGTGGCGAGTTAACACCCGGATCCGT
CTTCCCACCAGCATCGAATAGCCGAGATCCAACATCCTTAGGATCGTCAATACTTCCTTCTCCGCGATGCCATACTTCAGCTCGTTCTGCTTCAATGTCC
GGCTGACGAACATCACCGGCATGTATACGCCGTCGTGTTCTTGCATAAGTGACGCGGCGATCGCCCACTCGCTTGCATAGACGATCACTACCGGCTCCCT
TTCCGCATCGAAATGGCGCAGGATCGACGTGGCCGCTATCTTGCCCTTCAGTGCGGCGAAGGCTGTCTCGGCTCTGCTTCACTTCGTACTACGATCCTCC
TTCTTAACATCGTCGTTGTTGGGTTGCTCCTCCGTTGACCGCTGCCTCAGCTCTGCGAAGTCGACCTCTCGTAGCTCGTACAGTATCGCCGCATATACAG
CCAGGTTCTCGATGAAGCGGCCGTAGTAATTCAAGCTTCCAAGGAACGACTGCGTTGCTCGGAGGGACTTCGGGAACGGCAGATCGGTTAGAGCTTGCAG
ATCCTTCGGTTGTGCCTCCAGGCCCCCAGCGGACACTCGGTGACCGAGGTAATCCACCTTCTTGAGGCCCCAAAAACTCTTGGCTACACTGATCGGTAGG
TTCCACTCGTTGCACGCTTCCAGCCGTTTCCGCACTCGTTCACACAGGTGATCCCACGACGTAGCTGTCACCAAGATGTCATCAATGTACCAGCGCAGAC
GGCTCTCCCCCATCATTAGGCTCGCCCTCTCTGAAGAGATCGACGAGATCTTCTCCTTTCGAAGCTGGCGGGATCCGGAGGAAACCATACAATGCGTTGT
CGATCAATCTTTGGTAGATCTGGGGCGCGTTCTTCAATCCGAATGGCATCCTGTTCCACTCGTAAAGGCCAGACGGGGTGATGAAGGCTGAAATTGCCCG
CGCACGCTCAGTCATCGACACCACCCAAAACCCGCTCGCCATATCTAACGAGCAGTACCACAGCGTCGCGTCGAGATCCTCCAACAGGTCGTCGATCAGA
GGCATGGGGTAGATCATCAACCTCGTTAGGATGTTCACCAACCGATAGTCGATGCAGAGGCGAATATCTACTCCGTTCTTCTTGATGATGACCACAATAG
GGGATGCCCATGGAGACGTAAAGGGGCTGAGAATCTTGGCCGAGAGCAGCCCCTTGAGCAGATCCGCGAGCTTTTCCCGATATTGCGGGGCGACCTTGCG
CACACGCTGTGTGACCGGCTTCGCATCTCCAACGTCGATATCGCAGACTGCGCCGACGGCGGCCGGAGGTAGAGCGTTCCCTTTGTCGATGAGGAGATGC
TTGTACGCCCAGATCTCATCGATGAGGTTTTGGATCTCTTCTGGGGAGTTCGCTTCAGCGTCGCCTACATGCAGATCTTCCACCTTGACCTCTGCCGTAG
TGACCGTCACTTCGGGCAGCACCGCCAGCTTTCCCTCGTAGTCCTCTGCGTACAAAGCACTCGCCCTGCGCTCGTACGTCTCCTCTGGGGAGTCTGACTT
TCAATCTCCGCATCCGCTGGCTCCGT