Description :
From Genome Similarity Track
Location :
Scaffold_5:1368525- 1390791
Transcript NameFunction/comments
Physo_303298crinkler (CRN) family protein
Physo_303299crinkler (CRN) family protein
Physo_562637ribonucleoside-diphosphate reductase small chain
Physo_303300putative glycosyl hydrolase family 17 protein
Physo_317203putative glycosyl hydrolase family 17 protein
Physo_511371glucan 1,3-beta-D-glucosidase
Physo_303303Hypothetical protein
Physo_303304flagellar associated protein
Physo_303305Crinkler (CRN) family protein
Physo_562642Hypothetical protein

Sequence
22266 bases(100 bases per row)
CAGCGAATGGTCATTTGGCGGTTGTGAAATGGCTGCACCGAAACCGAGCGGAAGGATGCACCACAGCGGCGATGGACCAGGCGGCGCTACAGGGGCATTT
CAGTGTTGTTCAATGGCTCCACACTCATCGCTCGGAAGGTTGCACAAGTTCTGCCATCAACAGTGCTGCCAATCGCGGGAATTTCGAGCTCCTGCTGTTT
TTGCACTCGCAATGCAAGCAACCTTGCACGACGGAAACTATGGAATTGGCAGCTCGCAACAAGGATACGGGGGGTTATGCCTGGATTCTCGACCGCTATC
CCCAATTTCGTATTCCCCCACAGGTGTAGCGTGATCTATGAAAATGTTTTAAGTTCATGTACAGGTTCGCGTAATGGTTCGCGTAAATGTGGACCGAATT
TTGACTTTCGTTAAAAGGCAATGGAACCGACCAACAAGTGCTTTGCGTGCACGCCCTACGAAAAGACGATCACGGTGTATGTGTTAAAAATATTGAAAAC
TAAGCAAACTAAACAAAACTCAGCTAAACTAATACGCAATCATTCGCCGAGATGGTGGCAGCCCACTATATACTTCGTATTCATACGTACTTAATTGATT
TTTTTTATTTTTTTAAACGCGTCGAAACTGGCTTTGAATATGCCGCTGCAACCTAAGACTCACAGAAACCATTGATTGCATGGAGAGACCCTGAAAGTCA
GTGTGTAGTAGACGCGCGATGTATCATCGCGGTGACCGAGAAATACACTTTACCGCCATGGCAGTTCCACCTCAACCGTTTAATTGCTCCCCTCCACCAC
AGGACCGCCATCTTTGGCGTCGTTCTGGTCATTAACTAGACGATGAATTCGAGTCCCCACCATTGAGTGCGCATATTCGTCGCTCAGTAAGCCACGCAGC
AAATCGACAGCAGCAACCCCATCCGATACAGCAATAAACTTGTAAAGCTTATCCTCATTTTGTACGCGAAGATTGTTGTAGACCGATTCCTGAACGTACT
GTGACGCAAAAACTATGGACTCCTTCTGGAAGTGTTCATCAACACAATAATGCAGCAGATCACGCAAGTCGTGGTAGTCATCAGCGTTAAGCATTGCACA
CGCATCCACCAAAGATTCTAAGGTGACACAACGAATCGCACGGTCGATTCGAGGTTGACACTCGCCCGACCGATCAGGTTGCAGCACTTTTCTTGCGATA
CCACCCCACCGACGGTAAGAGTCCTCCACCTTGTCGACAGGAATTTTGTCAACATATATTGCTTCATGGCACCTGAGAAGTTCTTTCGGTGTCACAATTT
TTAAAACGAGTGATAAGTGATATGGTAGCACTTAGAGAGGAAGTACGGCGGCATCGGGAGCCGAGATGCTGTGTTGAGTACGCTGGAAAATCGAAACTGT
GATTGAGGTTAGTACCTTCGTCCTATTCCTCCTAAGCAATTCTAGTCCTTGGTGCCTGTAACTTCAACATCTAACTTCAAGCACATCGCTTCCTACATCT
TTAACTTCATCCAGATGACTGCGTTGCACGCGGGTCACACAGCTTACTGCAGCTTGATCTCCACAAAGTTGGCAGATCGTTACCCATTTTCGCGCTCTAT
GTGTTTGTAGTCGATAATATCGTGACATTCGGCCACACAGGCATGTAGAAAAATCCGCAATTCAATTTGCTGAATTCGAACCAGACTGAGCGCCTTGGTG
GCGTCAAAAGTATCGTCTTGCATGGATAATAGTGCGAACGGCCACGGTTCACTATGCAGTACGTCGTTGGCCTTCGTAAAATGGCGATAAAGTCTTGGTC
CGATCCCTTAGCGACCAAGTCAGGAGAGAACAGAAACCGCCTCCCCCCAGGCCCTGCACACTCGAAGACGACTGTCGCCCGAATCCGAGCAAGGTGCAGC
AGCACAACGAAACCGAAAAACGTTTTCCCGACCCCCGAATTGCCGAGAATCACAAGGTGTGGCGTACATTTCTCCTCGTCATGGATTGCCTTCATACAAG
TGTCCAACAGCTTCGGGTAGCAGTCACGAATGAAGAGTTTTGAGCCAAGTGAACGATCCCCAAGGAGATAAGTTCCTTCGGGTAGTGTGACAATGTTCCC
ACCCTCCATGGGGGTGGAATCCCTACCAAACGCTCTCCAAAACGAGACGAGATTCGGGAGATTCACGTGCATGGAGTGTGTAACAAAACAAACCACACCT
CCAACGACAACTTGGGACTGTTGGTTAGACCACGACGGCGGCGATACCACAACACACAGCGGATTTATGGGGCCCTTCCCACGATTCTTTAACGTAGCGA
ACGCATTAAGAGGCCGGTTCTCTCCGTACGCGTTGAAATCCTCGTAGACTCGAAGCTTAGCGGCATTAATATGTTTGGGAAGAGCAGCTCCAACCTTCTG
GAAAATTGCGTCCTGAACGTTCTCAATGCTTCTCTCTTCGACGAGGGGAATTGACTGGACGGTAGTGCCCATGAATGCAGCGTGCGTGACAGCATCCACC
AACTGGAACCAGACCTTGGGCACCTCTACAACCAGCGGGTCATGCTCGCTCTCTCCATAGGGAGACAACAGTTCCCCAAACTTCAGGTGCTCATGCGTTT
TGCTCGTAAATACTCTCAGGTCGTCGAGAGCGAGGCCTGACGGAAGCGATCCCTTGCGTTCAGCAAGTAATTCTATGCAGAAATCTTCAATATCCAAAGC
ATCCTCAGGTAACACTAGGAAATTTACCGACCCAGTGCTGGTTCCGCTCCCTAACTGATAAAAGGTTTTAATCGGCATTGTCGACTTGTCGAATTCTCAA
ATGAGAGGAAAAAGCCTGTGCCCAAACAATTGAAAGATTGAGATGAGAAGTCTGGCCTAACCCATCCACACTGTCGCATCCAATCTTCGAGTCTACGAAC
AACTTTACCACATATTTGTAGCTCCAAATCCGATAGTTTTGTCGTGATCCTGGTGTGTTTTTTTCTGCATGCCGCCCGGCAGAAATGTTATTGATAAGAA
TGTGTCCCTGAACTATCTAGCTTACCTTTTGACGAGTGGGTGTACCCGCAGCAGTACATCATGATTAAGTTTTTGTTTATTTTTTGGCAGAGGCGTAGTT
AGATTTCTTTGACACCAGCATTTTTTCCCCGAACTGCAGTAGACGATAATTTGTTTGCTTCATGACGGCACAGCAGTCCCGCGCAACAGACCGCGCAGCA
CATCATCAGGCCCAAAATCATCCACTACAGCAAGAAACTCGAGCAGTTTATCCTTGTTCTGCTTGTAAAGGCGCTTGTAGACCTCCTCCTGAACGTACCG
AGAAGCAAAACCCAAGCATTCCTTCTGGAAGCACTTCGTTACGCGATAATGAAGCAGGTTGTGTAAGGCGTGGTAGTCATCCGCGTTCAGCCTTCGACAG
GCAGTAACTAATGAGTTCAGGTTGACACTCACCAGTGCAATCTGGAGCTGCACCTGATGCGAAGTTGACGTAGCATTGTGTAGCACATAGCGTGCGTTGC
CGCCCCACCGACGATAGCAGTCTTCCTCCTTCTCGGCCGACACTTTGCCAGAATACATTAATGCATGGCACTTCATGGTCTCATCTTTCGACCACATTGG
CATCTACAGAAACTCACAGCCAAACTTTGTGAAATCGTACCAAAGTGAGCGCCTTGGCGGAGACAATAAAACCATCTTGCATGGGTAGCAATTTGGAGCT
GCACCATCCACAATATAGTACGTTGTAGACTCATCCAAAACGCCAAGAAAGTCTTGATCTGACCCCTGAACAACCAGGCCAGGAGAGAACAGAAACCGCT
GCCCAGATTCTCCACAACCGTAAACAACAGTCGCGTGAGCTCGGGTCAGATGAAGGAGCAACACCAAGCCAAAAAAGGTTTTGCCAATCCCTGAGTTACC
GAAGATCACGAGGCGTGGACACTCGGCCTCATCGCGAGTTAGCTTCATGCAAGCGTCCAATAGTTCTGGGTAGCAGTCACGAATGAATACCTGGGAGCCT
AGAGTCGGATCCCCAAGGAGGTAAGCTCCATCTGATAGCGCAACCACGTTGCCATAGCCGATCGCAGTGGAGTTTCTCGCCATTGCCTGCCAAAACGAGA
CCATATCCGGAGGATTCACCTGCATTGATCTAGTAACAAAAATCATTATATCACCGACACGAAGTTGCGTATACGGGTCGGGCTGCATTGGCGGCGGTAC
CACAACACACAGCGGGTTACTGGGGTCCTTACCACGATTATCCAATGTAGCGAACACCTCCAGAGGCTGCTTCGCTTCGTACGCGCTGAAATCCTCGAAG
ACGCGAAGTTTGGCGGCGATCATCTCTTTTGGGAGAGCGATGGAGAATTTGATGGAAACGGTGTCTCGTAGACTTTCTACGATGTTTTCTTCGGTGAGAG
GGGCCGACTGCGCAGTGGTGCCCATGAATGCAGCGTGCGTGACAGCATCCACCAACTGGAACAGACCTTGCCCACGCTCTCTCCATAGCGCCCCAGTGGT
GCCCCCAACTGTAGACGTTCGCTTATCTTACTCGGAGATACTTTCCGGTCGTCGGCAACAAGGCCAGGCAGAACAGGTTCGTTGCGTACATGCCGTAATT
TGTTGCAGAAATCTTCAGTATCCGAAGTACCATTAGGCGACCCAAGGTAACCCACCGGCATCGAGACTTGTCGCCTTCTGCGCGAATTCTCAAATGATGA
AATGAAAATTCTCGCCAGTCGCTACGATTGAAAGATTCAAACTCATAGGCGGTGAACCCACAGCATTACCGATCTACGCTCTATCAATCGCTGTTGGACT
TGATGGTAAAGCAATGTATCATTTCTGTGAACGCTAGGATAACATTCGTAACATTTACTTTTTAATTACGCGACGAAGCTGGCTTACAACTGCCGTTGCT
TCTTCAAACTTACAGATACTTAGACATGGCCAACGCAGAGCCCACCCAATCACACCATGGACACCCCATCGACGCCGCACTTAGAAGTCTGCGTCGAGCG
TGAAGACCTGCTCCTCGGCCGCGACGCCGACGCCGGCCTTCGAGTACTCGCCCACACGCTTCTCGAAGAAGTTGGTCTTGCCCTGCAGCGAGATCATGTC
CATCCAGTCGAAGGGGTTCTTGACGTTGTAGAGCTTGGGCACGCCCAGCGAGTACAGCAGGCGGTCGGCCACGAACTCGATGTACTGGCACATGAGCGTC
GAGTTCATGCCGATGAGCTCCACGGGCAGCGAGTCGCACACGAACTCGTGCTCGATGGTGACGGCCTCACGAACGATTTCGTGCACGCGGCTCTCGGGCA
GTTTGTTGACCAGCTTGGAGTACATGAGGCACGCGAAGTCCGTGTGCATGCCCTCGTTGCGGCTGATGAGCTCGTTGGAGAAGCTCAGGCCGGGCATGAG
GCCGCGCTTCTTGAGCCAGAAGATGGAGCAGAAGGAGCCCGAGAAGAAGATGCCTTCAACCGCAGCGAACGCCAGCAGACGCTCCGGGTACGACGACACC
CGCGGGTCGCACCACTTGAGCGCCCAGTGCGCCTTCTTCTTGACGCACGGGATCGTCTCAATAGCGCGCAACAGGTGGTTCTTCTCCATCGTATCCTTGA
TGTACGTGTCGATGAGCAGCGAGTAGACCTCGGCGTGGATGTTCTCGATGGCGATCTGGAAGCCGTAGAAGCAGCGCGCCTTGGGCACCTGCACTTCGTT
GCTGAAGTTCATGGCCAGGTTCTCGTTCACGATGCCGTCGCTCGCCGCGAAGAAGGCCAGCACGTGCTTGATGAAGAACCGCTCGTTGTCCGTCAGCTTC
TGCCAGTCGTTCAGGTCGTGCACCAGGTCCAACTCCTCGGCCGTCCAGAACGAGGCCTCGGCCTTCTTGTACATCTGCCACACGTCGTGCTCCTGGATCG
GGAACAGCACGAACCGGTTCGGGTTCGACACCAAGTACGGCTCCGGCTGCAGCTCGCCGTTAACCTCCTTGCGTTTGTACTCAGACATCTCGAGCTTCGG
CTGCTCTTCCTCCTCCTGGGACTTGTTGTCGTGAATGACAATTCCTTTGGCGAAGTTGTCCACGAACTGCGGGCTCAGCTCCTGCTCCGGCTGTTCCGGC
GACGCGACCACCGCGGCGCGCACAGTCGAGGCTGCGACCATTGTAGCGCTGCCTGCAAACTCGAGCTCATTCGCCAACTTGCTCCCTTCGTCTCATTCCC
CGTACAGAAGCTCGCAATGGTTTACGTCTCCGCGACGTCCTCACTCCTCACCATCGCTGCGCTAGTCGCCGTCGCCACCAGCCCCGTGGAAGGCGTGGCC
TTCAACTGCCCCGGCATCAACTACAACATCCGCGCCGGCGCGGACTGCGGCCCCCGAGGTCAAGTGCAAGTCGGCCTCGCAGATTGCCAGCGAGCTTGAG
ATCCTCAAGAGCCACACGAACGTGCTGCGGCTGTACTCGCTGACCGACTGCGACCAGGCCACTGCGCTCGTGCCAGCCGCGATTGCAGCGGGCTTTCAGC
TTGAGCTGGGTCTGTGGGTGGACTCGTACGCCTCGAGCTACTCGGCCGAAAAGGAGGCCTTTGCCACGCTGCTGGACACTGGAGTCGTCACGCCGGGCAA
CATCGTGGGGATCCACGTCGGCAGCGAGGCGCTCTATCGTGGGGATGTGGACTATCGCACCGCCGTGGGCCACCTCAGCGAGATCCGCCAGATGTGCATC
GACAATGGGGGTGCAGCCGAGGTCCCTCTCACGATCACCGACGTCGGCAACACGTACTTGGCGTACCCGAGCCTCATCGACAAGGTCGACGCGCCAGCAA
GAAGCGCGTGGTGATCGGAGACCGGGTGGGCCACCAACGGCATGGACGCTAGGGCCAGCGTGGCCACCGCGGAGAACGCGGCCAGGTACTTCCACGACTT
CTATCTGCAGGCCCAGGAGAAGGGCATCCCGTACTACTACTTCTCGGCCTTCGACGAGCCCTGGAAGGGGACCGACACCGTGGAGGCCTACTTCGGCTTG
TTCCACGAGGATGGCAAACTGAAGTCGTCCATCGAGGGGCTGGAGCTGGACAACGAGACCGCCGAGACGTCTGAAGCAGGCTCGACCGAAGCGGAGCCGT
CGCTAGCAGCAGTAGCAGCACTGCCAGCAGCAACGCGACGGGCGCGTCCGGATCGGCAGCCGAGGAGGTACCGTTTGCGAGAGCAAGACTGACGAACCCG
AGTCCACCGTGGCGCCCGAGTCCACCGTAGCTCCCGTGTCTACCGTGGCGCCCGTGACGTTCGATTCCGCAAGTGGCGTCGCGGAGACTTCGTCCAGCGA
TGCGGGGACTTCATCCGAGGGAGCTGACACGACGACGGTCGCAGTTGGAGCGAGCCAGGTCGCGTCTAACGACGGCAGCAGCAGCAGCAGCTTGATCCCC
ACCACCACCACCACAGCGCCAGCCACCGACTGCGCTATGATCTAGGTTAAGTTAGTGTAAGCCGCCGCCAGTTGCTTCATCGCCGAGCCCGCGTGTTGCA
CTGTCTTTATGTTTGCCGGCGTCCCTGACAATCCATGTGCGTTGCAAATGAACGATGACTTCCACAGCTATCTTCCCTCTGCAGCGCAAGGGGGCAACCC
TCTCATAACAGAGCTTGCCTCATACTTAAGTAGCGTAATGCCGTGCCCACTTTGAAGTCGACGGCATGTGGCCATTTCCAGCACGCGCTGATCGTCGGCT
CGAACAGTGACACTCGGTGCCTGTTGAGCGTGCCGGCGCCACGACAGCGGCACCGAAAGCTCTATAGTGTCCTCGACCGAGCGATCGATCGGGAAAATCA
AGCTCGTGCAAGCATATAACCCCGGGGCGACGACGAAAGACAGCTCGCCACCAATGGCTGCATCGGTCGAGGTCGATCACGCACCGAATCTGCCCGTATC
GTCGATACTATCGATGAGAGCGAACACTGACGCATGGTTCCAGCGCTTTCCGCCGCGTGAAGGCATACATGTACTTAGTACGCCGTCGGCACCCATTCCA
CTCACCGAATATGCGCGCGCAAATCCTGCTCGCGCGGGCTCTGACGTCGCTCGCCAGCTGACACAGGTTTCGCTACTCGTTCGGTGCTTCAGCTGCCGAA
ATATCCAAGCGGAGCGTCAGGTTGCAACTTTGACACGCGATCCAGATGGCACTTGCGTTGCCTAGCAGAGATGCTGGCCCTGCCAACAGGCACCCCTGCC
TCGCTTGAGGCCGCTAATGCGGCCCGAGCTCCCGGTCATTTCCAAAACTCCTATCCCCTCGATACGAGTATTCCCCCCTCCGCTCCGAAGCTCCACACAG
CGACGACCAAGACCCCACTCTCCACCATGGTGAACGTGCTCCGTATGACCTCCGCTCTGTCCATGGCCGCCGCCACCTTCGGCCTGGCCAACGCCGGCAG
CTTGCTTCAAGTGCACGGGCATCAACTACAACATCCGCGCCGGCCCGGACTGGGCCACCGCCGACGTCAAGTGCAAGCCCGCCTCGCAGATCGCCACCGA
GCTGGCCACGCTCAAGGGCGTGACCGACACCATCCGCCTGTACTCGCTGACGGACTGCGACCAGGCCACCGCCGTGGTGCCCGCCGCCATCGAGGCCGGG
CTCAAGATCGAGCTGGGCATGTGGGTGGACTCGGCCGCGTCCAGCTTCGAGGCGGAGAAGGCGGCGTTCCAGACGCTGCTGGAGACCGGCGTCGTGACGG
CCGACAACACCGTGGGCATCCACGTCGGCAGCGAGGCCGTGTACCGCGGGGACGTGACGGCTGCCGAGGCCATCTCGAACCTGAACGAGATCCGCACGCT
GTGCCAGGCGAACTCCGGAGCCGCCGCCATCCCCCTGACCATCGCCGACATCGGAGACACGTACTCTGCGCACCCGGAGATGATCGAGGCCGTCGACTAC
GTCTCCGCGAATTACTTTTCCTTTTGGGAGAAGGTGGCCATCGACGGCGCCGCCGAGCACTTCTACGAGCGCTTCTCGGCGCTCGTGGAGATCGCCAGCG
GCAAGCAGGTGATCGTGGGCGAGACGGGCTGGGCCTCGGACGGTGTCGACGCCGACGCCAGCCCCGCCACGGCCGAGAACGCCGCCAAGTACTTTCACGA
CTTCTACACGCTGGCCGCGGAGAAGGACCTCATGTACTTCTACTTCTCGGCCTTCGACGAGCCCTGCAAGCTGGCCACGCTCGAGGCCAACGAGACCGTG
GAGGCGTACTTCGGCCTGTTCACGCAGGAGGGCGCCCTCAAGGACCTCATCTCGGCTGAGTTCGCCAACGCCACCGCCTCCTTCGACGGCAGCGACTCGG
CCACCATCACTGCGGTCGGCGCTGACAGCTCTGCCTCTGCTTCTGCTGCTGCTGGCGCGGTGACCACGGTCAACGCTGCGTCTCCCACGTCGGCCGACGT
TGCCGCTTCCTCGGAGGATGACTCGACCACGCAGGGCGACGCGACCCAGGACGGCGAGACCACCTCGGCCGTGGACGCTTCCTCGGACGAGGAGACCGCC
TCCGGCAACGGCGAGGACGACTCGACCACGCAGACCTCGACTGCCACCACGCCGTCGTCGCGCAAGGACTGCGCCATGTAAAAGCTGACTGATTCTGTAG
CAACTGAGAGCGCGTGGGTCGTCGATCGACCATCGAGTCTGCATGTAGACAAACGAAAAGTGAGTCAGCCCATCAATACAACACACAAATGAGCCATGAG
CTTCATACCAGTCTACGGGTCGAGTTCTCGGACGACAGCGGCGAAGTCCCGGAGGGGTGGAACGCTGGTGTGACCTCGAGCCGCGCAAGTGATCGGGTTT
GCTTGGCTTAGCGTGGTGAGCCCCGCAACTTCAACGAAGTTTTGGCCAATGAAAGTGAATCATTTAAAAAAAAGCAATGGAAGCGAAAAATATTTTTTTC
TCCAAAAGAGGGTGGGCGTAGCTCCAAAACCAGGTAGCCTTAACAAGGTCGCTGCGGGCTGGACGGAGACGCTTCTGGCAGTGTACGACTTGACTTATCC
ATGCTCCACAGGAAACTCCAAAAGGTATAATACATGTACTGACAAATCACAGCATTACGATACGACCCCAAACGCAGCACAGAATCTTCCTCAACACCTT
GTCCAATGGACACTGTAATTACCGAGGCGCAGATGTCGGGATCAGGAGCCGACACCGGTTACATGTAAACTCACAAGACCATGATCAACCCGAGTTTTAT
TCCGCTGTCACCGACGATTGCGATCGAGCTGGCCGTTGTCGGTCTGCCTGTCAGCGTTCCCTGCACTCACCCAGCTCTCAGCTTGTCATTTCGGATCTAA
CTCTCGACCCAGCAAGCGACTCGACTCCTCTCTACCAGCCCTCTCCCCAAGCCGAGCATTTCAACTTCTCGCCGCATCGCTCGTCTCCACCGAGCAGCCA
ACCCTCTAGTCCAACCCTTCTGTCACGGTCCATCCATTAGTCACGGTGATTGAGGACACTTTTTTGCTGTTCGGTGGATGACAAGGTGGTCAAGTTTCAC
GTGTGGAGCTTACATGTATTGGATGTGCAAGGATGCAGTGAAGACTAGTATTCGGACGACAAGGTGGTGAGCCTGCTTAGACGCGCCTCACGCGGCAGCC
TCCAGGCCTGATGGTCGCCGGAGTACCCTCTTCCGAACCCTTGGTGCTGCCGTAGGTCTGGCTTCCGCTCTTGCTGGAGCCCGTGGTGCTGGCGCTGGCA
CCTTCGGTGCTGCCGTAGGTTTGGCTTCCGCTCTTGCTGGTGCTGGCGCTGCCCCCTTCGGTGCTGCCGTAAGTTTGGCTTCCGCTCATGCTGGAGCCCG
TGGTGCTGGCGCTGGCCCCTTCGGTGCTGCCGTAAGTTTGGCTTCCACTCTTGCTGGAGCCCGTGGAGCTGGCGCTGCCCCCTTCGGTGCTGCCGTATGT
TTGGCTTCCGTTCGTGTTGGAGCCCGTGGTGCTGGCGCTGGCCCCTTCGGTGCTGCCGTAGGTCTGGCTTCCGCTCTTGCTGGAGCCCGTGGTGCTGGCG
CTGGCCCCTTCGGTGCTGCCGTATGTTTGGCCTCCGTTCGTGTTGGAGCCCGTGGAGCTGGCGCTGCCCCCTTCGGTGCTGCCGTATGTTTGGCCTCCGT
TCGTGTTGGAGCCCGTGGAGCTGGCGCTGGCCTCCTCGTTTCTGATGACGGGGCAGTTGGGGCCCAGGGCGAGGTTGGCGATCTCCGCCTTGAGCGTCCG
GTCCTCGTGGAAGAGTCCGAAGTACCCCTCGACGGTGGCGTTGCTGGCGGTGATCTTCCACTCCTCGTCAAAGCCCTCGAAATAGTAGAACGGGAGGTTG
CGCGCCTGGGCCATCTGGAAGAAGTTGTAGAAGTAGCGAGCCGCATTCACCGGAGACGCCTCGGACGCCTTGGGGCTCGAGCCACCCGACGCCCAGCCAG
TCTCGCCAATCTCCACCCTCTTGCCGAGCGCCGCAGCCTGTTGGTACAGGGGCTGCATCCTCGTGTCGAAGTACTGGACAGCGTTTTCAACTGCGATCTT
CTCCCACATCGGAAACCCATTTGCTTGAACGACGTCGACAGCGTCGATGAGATTCGGGTGCGCCAAGTAGACGTCCCCGATCTCGGCGATTGTCACGGGC
ACAGACGCCAAGCTGTACGCGGCGAGCAGAGCCTTCACTCGTTGGAGATACGCAATGTTCTCCTCGGCCGTGATCTCCTTCCGATACACGGCTTCGCTCC
CCACGTGGATGTCGACGATGCTGCCGCCCGAGAAGAGACTCGAGTGCTGCTGGATCAAGGTTTGGAGCCTAGAGAACTCCGCATCGAACACAGCTTCATC
CCCACTCACCCAGAGGCCCAGCGACACACTCAGGCCGGTGTTGATGGCGGCAGGCAAAACTCTGGAGACTTGGTCGCAGTCCCCGAGCCCATAGAGGCGG
ACGGATCCCGTTACTTGATACAGCGTCTCCATGTCCGCCTGGATGTCCGCGGCGCTCTTGCATTGCTGACCTTGAGCAGCCCAGTCTGGCCCGATGCGGG
GGTTGTAGTTGATGCCGTGGATACAGAAGCTCTGCGCCGCTTGCTTGGTCAACAAAGCGGAGGTGAAGGCTGCGATGGCACCGAGCAGCTTGAAAGATAG
CATCGCTGGTGCTTGGTGGGGAGTCATGTTTTCGAGGTCGCTGAATTGTAAATGAGCAGTCTGGGAGGACTGGAGGAGCCCCAGAAGCGGCAGTATCGCA
CTGATCCTTCGACACTGACACTCGGTGGGTTCTCCACACAAGCATGAGCTTGTGTTCATGCATGAGCCCAGTTGCAAGTGTAACGGAAACACGGTGTGTG
CGTTGAACGCCTCGTGAGATGCAGTCAACTGCATCTCATGACAGCGCTTTTCGATGATGCACGCAGCTCATCTGTGATCGCGGTGAGATGGTAGCTCGCG
AGTGCTCTTGAACACGTGAATATGTTGCTTGTGTCTATGGGCCTCACATATGGGGACGGGCGTGGAGGTGTATTCAAGAGCTTAGATTGACAACGGATTC
ATCCCTAGGCTTCTGCGCGACAGCGGTGGCCTCAATCGAAGTCGAAGTCGCAAGTTGAAGTCGTCCGTTTCCGTTCAGGAGAAGTTGAAACGACCATGGT
ACGTTGCACCGTAATCCCAAGTGCAGAGCTTCGTCGTGACTCAAGGAGGCTGGCACAGGCTGCAGTGGTAAGCTGCAGCCACATCGTTGAGCGCAACCAC
ACCATCGTAGTCGCAACATCCCCCTGCGAGTTCTTGGAATGCGAAGTCGCCACAAATTTGCACTCGGCGGAGCTTAGTACTTCTTGCTCCATGGCATCGC
TACACACCCGCATTCCAGGGTGTGGTGCAACGGCGGGTTCAGGCAGGCGTACGCCACAGATTTACCAGCAGCAACAACCTTGTTGCGTGAAGTCGCGCGG
TCTTAGCGCTTGAGGCTGTGGTCTTTTCGATTTGGTCCAGAACAACGGTACGTATTATAAACATTGTTTGTAACGTCGGTAGTGAAACACTTTAGCTACT
GTACTAAGTAGAATTTACGAAAGTGATATGTAAGTAGTTGTGTAGCTCTACTACCGAGCTTCGCTGCAAAAAAGCTTGTTCACAGGTCGAAGACCTGTGC
TTGGCCCCGGCAATAAACTTGTAACTTTCCAAAACCGGGTACCAAACCGGGTCTCTCTTTCTTAAGCAACTTTGTGATCATCACTCTAGTTGAAGTGACA
CGTACAGTGTGGTTCTTCTGCCCTGCTATTAATAATGAGAGCGCAGCTAGCCCCCACGACCAGCACACAGCAGATTTGAACCCCAATGGGACCCCGCTTG
CGAATGTTATATACCCAGCAGCAGCCAGCTCTTCTTCCACCGATCGACTGCAGCTCACGTCCGTTTGCCGCAGCCCTCTCGACTTCCCCTTATCGAGAGC
TCTCCCAGGACCATAAAGATGCCGACCATAACCGCGATGGATCGCCCACTCATTCGCTATGCGCTAACGACGCCCCCCGTTCCCTCTCTGTTCGAAGAAA
AGAGCCCCGTGGCGAAGGTCATCTGCTTGGAGCCTGAAAAAGAGGCTGCGCAGTCCTTTGGGGTCCACATGAGGTCTTGCGTTTGAGTTGTTGAAGCAGA
GCAGGGTCGGATCTATCAGGCAAATGGGGGGCGCATGCCTCCCATTTTTTTGGCTGGTCGTTATTTTTTTGATTGCCTCTTTCGGTTGTGTAGAGGGTTT
GCCATTCCTAGAATCTCGTGTGCAACCAGCATGAGCGGCAAAAAGCGGCTAAAGGCTACGCCGATAACAACATTTTTCAGCAAACAGCCCCGCGTTCACT
CTCCCAAGCGCGAGCTACCCAATACGCTTCCAGAACCTCTCCCTCCTACGCTCCAAGAGCAAGATGACAAGGCCAACGTGTTATGGTGCACTCTCTACAA
TGTACCTAACGACCTCAGACTTTGTTGTAAACGATCCTGCGCATCGCCCGCCGAACCTCTTCCGTGTTCGACAACTTGTTGCCGCCCCCTCTCTTCTGAG
TCAAGTACTGCAAATGTATGCGCGAAAAGGGCCCTACCAACCGAATTAGAGTCGCAATTCGGAGGTCGGATGGTGCGGCTAATGGAATTGTGTGGCGGAA
TAAGTCCACGTCGCTCATTTGCTAGGTGGAATACTGCGGATATTGTACGAATCGCGTCGGACTTTTACGCATTTGACTTTGACGGCCATAGAGAGCCAAG
CCAACAGATTCGTCAACACGGCGAAGAGGGACAAACGATTCGCTGGGCTGGTGTTTACAGAGGAACTCAGCAAAGCGTTGACCTAGCAGGACATGATCCC
TAGCTTCCCTACATTACACCGCTTGATTCGGCTAGTATGTGTTTTGCCAGTGTCTACCGCAGAAACGGAACGCTCTTTTTCGGCCATGAAGAGGTTGAAG
ACAAGGCTTCGAACGACCATGCGTGAGGCATGGGTGCTGGATTTACTGCTGCTCAGTATCGAGAATGATTTATCTGCCACGGTAGATCAAGAAGCTATCC
TAGACGCTTTTCGTGACTTAAGGGACCGTCGTATCCTCATCTAGCTCGACCCCCCAACACAAACATTTTTACAAATATTTTTTAAGCTGGAGTTGCCCCC
CCCATTTTTTAAGGCCAAGATCCGCCCCTGAAGCAGAGCCACGTCGTGCCGTCGCAGAACAGAGCAAGCCGGTCGACAGTCGATCGGGCCTTGCGTTGAG
TATTACCTCTATCCCCCGAGCCCGCAGCAGGCCACGGAGAGCAACCCCTATCATGAGCGACGGAGCTCTGCATCGACATATATTTCGTCCTCAACATGGG
CTCTGTCTTAACGGAGGTTGTCCGCTACAGCAACCGTCTCACCAGCTTGTGAAGTCTCTCCAATGCCGCCAGTGTCAAATTTATCGCCAGCGTCTTCCGG
TTCACTGTCCTCCTCCGTGCCTGTGGCACTCTCTTCTGCAATAGTTGCGCGCTGCACGGGCCGCTAGACACTCACGCGTTGAATGATCTCCATGAAATCG
GCGAGATATTGTTTTTGTGGCCCATGGTGGTAATCTCGTCCAGAACCACCAGCTTGCACGCCAGGAACGGATCCTTCACGTCGCGCACTCGGAACGAATT
GGAAAATATTTGCTAGTTTTCTCTGTGGAAGCGAAAGAACAAAGGATGTTGGCATTTGATACGACACATGGAGTGACTTACAAGAGGGCGAGAAACTCGA
CAAGATGCATCCCCTGCTTCTCGCCAGGCTTGCAATACTTGCCCATGTGAGCATCGTATAGCTTATGTAGCTGTTATACGAACGGTTAGATGATACCAAC
GATTGATTCTAGATACCCAAGAGAGAACAGACGCACCAGGGTTATGTGCTCCGTGAAGACGTCACTGACCTCTTCCGTGTACAGGCCGGAACTCGTTTGC
GTCTTCTAAACTCTATTTTCCTGCATCAGCTTGTCAACAGCTTTTGCGGGGGTATCGCACGCGTTGGCTGTAAGAAAGAAAAGGGGGAAATCATACCAAA
TCAATTCTCAATACAGCAGAAGTTGAGTACTAACAGAGCGCGTACTTTGAAAGTATTTGCGATGCGAATGACGCACTCGAGAAACCCGAACCGCATGAGA
CTGCGGTCTGGGTTGCCCTTCTCCTTCGCCTCCTGCGTGAGCTCGAGGTTGGCCGCCACGAACACGTTCTCCAAGTCTGGAAGCGAACAGTACTCGGACT
GCTCGTCCAGGATACGAGCTTCTGAAATAAACTCTGTGAACCTGACCACGGCACGCACGTTATGTCATTCTGCAGCTGCACTGCAGCTGCTGGCGTGAGA
GATCCTAACGGCGCCAGGTTCATTAGAACATTGTGACCGCAATAGCGTCGGTAGCCATTGCACACCGTGCGATACGAGCGCGTAACACTGAGTTCCACCT
CGCGCCGACGAATCTGATCCTTCACGAACCGGTCGATCTTGCACTGCCGCCAATCCGCGGCACACGCCTTCGCGATAAATTCGTCCGTGTCGACGCCTTT
CGCTGCTTTTGCCCGAGCTGCGCGGCACCAGCGTGTTGCATGAGTCTCGACCTCCACGCTGGGTCAGACGAAAGTCAAGTCAGAAGGTATCGGACCTAAA
AGTGTTCACCAACATGGCTGCGTGTGTGGCTGTGTTGAGCAGTACATCCGTCGACTCCTTCCGCAGAGCAGCTTTTCCTACGTTTTCTTGCTGGTTTCCC
GCTTATTTAACTGCCTCGAACCTCAACGTGTTCACCAACATGGCTGCGTACCAGAATGAGACTCCATTGAAAGTGTCCGAATCTGTGGGGACCTTGGGGA
AGAGCCCTGTCGACCCGCTGCTCGTGGAGATTCCCAAGGTTTGGTTTGGGAACAGAACCAAGTTTTGGTTTCTGTTGGTGGATGCTGGTACGCGGGACAC
GCTTGCGGGCACTAGAGAATATTCGGTCTCTCTAATTGAAGAGGCAGTGCAGGTGGAATAGTACTCGAGATGCTTTTGCCACACACTCCAACTGAATCGC
CGGTGGAAGCGTGTAAACTCAAGATCTTCAAGAGCCGCCAAGCGTATGAGCCATGGGCGAAGATGATCAGATTGGAGACCAAGCAGAGTGCGCTCATTGT
TGAAGTGCCAAGCCTCCCTGCGATTGATCCAGCGTCAACTCGGTTCCCGTAAAATGGATCAGCTCGAAGACGCTCTTGAAACTGAATCCCCACGAAAGAA
GCCTAGGCTGCTACAATCACGGCTTGCGCCTGCAGTGCCAGTGTTCGAGGGCTACTTCTCGGTTCCATTGGAGAGCATCGCCGCCTTCCAGACGATAAAG
CAGGGGTTCTCCGACACAAGATTACCTGAACGACCGCTGTTTCTGCTCTATGGTCCTCGACAGTTTGGGAAAACAACCATTGCCTACGGATCGACACCTG
GCTGGCTGCTGAAGTTCCTGATGTGATGTGCGATTCTATCGAGTTGCTGGGTATCGAAAACGGAGCCCACTTCGGGCAGAATTTGGGTGATCCATTCGAC
ACGCAAAGCACATGCTCAGACTCGGTATCATTGCTAAATGTGGTGGAGGCATCCGCCGCGCGCACGAAGAAAAGGGTGTGCCTTATCGTGGACGGGGTGG
ACTCCCTGTCCGCGGACCGAGCTTTGATAAGGGTCTTTCTATCGGTGCTTCGTGAGTTAAAGGTGACATCCTACTTTTATGGATTCCTTGGGGTCGGCAG
TTCCGCTTTGGCGTGCCACCATGAGCTTGCTTCTGACAACCCACGTGCTAGCTTATACGCTGAAACCAAGCTGTTGCAAGCCGAGTCATTTTCAGCGATG
CAGATGGCTGCGTTTTTCGAGCTGATCGAGCCATGTTTTAACTTTGCGAAGTCTCTTCGGCAGGCGATTATGGAGTATTCTGGTGGCGCACCTGGCGTAT
TTGGTTCGCTGGTTCGCTACATGGCTACGCATACGAAGTGGACGAAAGAGTGGTGTGAATAGGAGCCCTGGTTTAAGCTGGTTGCCTTTTCGGATTACCT
GCTACTCAACAACGCGTACTTTTGTATGAATAAGGAAATATGCGGCTTGGCAGCGTTGGAGAGGCGAGCACTGAAATATGCGCTTCAGGAAAAAAACGTG
ACCGCCAGGGAGTTGCAGACACTTTGTGGCGAGTCTATCACGAGTGGAGAGAAGATTGCCGACAAATTGCTAGACGTGGGAATTCTGGTACAAGCAATGG
ATGGAAAGTTCCGAGACGGTGCACCGCGTTTGTGTCGAAGCACTGCCCGAACGAGATGTACAAGCTATTGAGAATGCTGGAGACCCGCTGGTGCTGCTAT
CTGCTGCCGTTCGTGAGATGAGACCAGAGGTCATTACAGACCTTGTCTTCGGAAACGATAAATGTCCGCCTGTGGCAGCATTTCACCAGGAGTTGTTCTG
TACGATGCGAGATATTTTGAAGGAGACGCAACGGTTTACGAGAGACCGTCTCAAAGCGCAGTCGCCCAACAGCGCACACAGAGCCGATATTATCGTTGAG
GACGAAAGTGTTCGATTCGGTTTTGAAGTGAAAGTCGGCTTGTCAGACGAAACCGCGGTTGTTGGGGCGGTGCGGCAAGCTGACGAGTATCGCGTTTTCT
ATTCGGCCAAGCAAATGTTCCTAGTGATTTTTACTCCGCCTGGGAGCAATTCCCCTGAAGTGAACAGCGTGAAAGAGTTCCCCGAAGTCAAGATCATTCA
GGTTCGCTTCGATGAAACTTGCAATACGTTCTGTCTTCAGCTGCTGGAGTAAATGGGCGCCAGAGGTCCGAAAATACAGTACTATATTGAATTGAGTACG
AGATCAGACCGTAATAAAAATTACAATTCAACAAGGAGAAATAATAAAAATTGCCGCAATATACATATACTGCTCTTCAATTTGAGGCATTTCTACAGAA
GAAATAAACCACTTTCTGTGCGTCATATGATTACAGAGTCGTTTGGAAACACTTTTTGGGGTGTTGCTTTAGAAAACTTTGCATGGTGGATGCTTAAACA
ACCTACCGGTAGTAATACGTGAGCGAGATATATCTGGATCTTGCTATATATCGTTAATCTGGTGTAGTGGATTCCAGGGTTTCACCTTGGTATCACCGCA
GTTAAGGGCTCGATAGCATGTCGCGGCGGTGACCCACGCCAGCCACAGGTAATGGGTTCACCGCATCATGACCAGTCAAGCTTCACACAGACACACTTCA
TAGTGTGTGCACCTGATATGAGGTTACAGACTAAGCATTTTGTATGATCAACTGCTTCGCGGACCCACTTCGCTTTTTCTCCTAAATTGCCTCAAAAGGC
GTACACACTATATCAAAACATAAAGCTCAAGTCCCTAGTGGATTGCCATCCGCTGCCGTCCCCTGATGTGATGTGTTCGGCGGGATTCACTACATCTGGA
CGTCATTGATGTTCTGACTTGCGTACATATTGGTTTCTAAAGATGTTGATTGCCCATTATGGCTTTTACTGCTCCTTAATCGTTGCGTATGTAGACCTAA
CTATCCTGTTATGACGTACTTTGCTATGTTTGGCGCCCGTGCAACCTTTTTTCATATTAATTGTCAATAATTGGTACAATACTGTATTGTATTGGAATCG
TTGATCTCCAATAATAAAAATTAGTATTGCAAAACCCAATTATTTATTGGATCGCAATTATTATTTCGGACCTCTGATGGGTGCCTGCCAAAAGGGTCAT
AAGGACCTAACATAGTTACCGCAGATATGCGGGTGGATATGTCGACATATAGCCTAGTTGCACCCGCCACAACATGCTTATCGACAACAACTCCGTTCGA
TTACAAATGCCCAAGTACCACGTCTATTCGCCCTACAGCGTCACTTTGCTCCGGACATTCCTATGGCTAGATCTTTCTGCAGTTTATCTTCTGCCCACGC
TGCCGCGGTGATGGAGCTCCAGAATGATACGTGCGACGCTCTGTGTGTGCTGTGCAAGGCCTACGTGAGCTACAACAAGGACCTGGGCGCTGTTCGACGC
GCGATTCACAAGCGGCTGGTGGAAGAAGATATATGACAGCCTGTCATTGACAGGCGATCTTCACAAGAATGATGGTCGACATATTCATAGTAAGTCGTTA
AGATGGGTACACGGCATAACCGCCAGTTATCGAGACGATTTTCCGGTCTCACGAGATTTATGTTAGCTTATGCCGAGCATATCTGCTGCATTTACTCCGG
GTCCTTATGACCCTTTTGGCAGGCACCCAATGTAGGAGGACAGGATTAATTGATGTATCTACAGTAGTAGATATTAATGATGCTGGAGTGTGTTCAAATT
GGCAGACGTAGTTTATCACGGTATGGTTTATACGTAGTCTATGCTGATAGTCTTGTAGTCTTGAGTAGTCTGTACTTCGGTGATCTCTCTTTATGCATTG
ATAGCAAAAATATGTTGATAGGTACTGTATGTAGCTCAGCTCAGGCGACGGTGGACGAGTGCAGCTCCTGCTCGAGCTCCCGCAGGAACAGAGCGAGGTA
GTCCTGGTCCACGCGACGCATGGTGAGCTTCTGCTGCAGGGACACGTAGCCAGCGAGCTTGAGCAGCTTGATAATGCTGGGGGTGGCCTTGAGCATCTTG
GAGTAGCGGATGTCGTCGTGCTGCAGCGTGCGGAACTTGGAGCGCACGCCCTCGCGGTGAAGCGAGCGCAGGACCTTGAAGATGGACGTGAGCTTGCGCG
CGCGCTCCGTGTCGGACGGGCACTCGCAGCGGCAGCTGGCGAGGCACGCGCGGATCTCGCGCACCGCCTCCTCGATTTGGTGTGCTGTGGGGATGCGATC
AGGAGCATCGTCGCTCCATGACGGCTTGTCGTAGTCTTGCGGTTCACCGGACGACGCGCCACCCATTTGACTTGACTGGAACGGGAGCGACGAGCTTCGA
GGACGAACGAGTCCCGCCATGAGCTCTCGGAGCTCATCTCGCTCGTCCCTATTGACGGCAGGAGCCGGGGTCAGTGGCGAACTGGGCGAGTCAGCTGGGT
TGATCGGTGGGGACGCTCCAGCCTCGGCCGTCTTCCTCTTTTTGAGCAACGCACTCAGATCCTCCTCCACATAGAACGCGTCGGGGCCCTGGTACTTCTT
GAACTGAGGCTCGCGGAGACCATCGCTGCTAAGCATCGACAAGTCATCGGACGAGTCATCGAAGCTCTCTTCGTCGGATGAAGACGAAGCGTAGTCGTCG
TCACCGCCGTATCTGGTGCCTCCAGTCGTGCCCAGCGCCTGCAAGTAGGACCCCTCGGTGGGGGAAGCAGAAGGCCGGTTAAGACCTGGTGCTTTCTTGG
TGCTGCCGTTGCTGCTGTTCAGGTCGCCATTCGGCTTAGTCGACTTGTTAAACGAGTGCCGCATTCTGTAATCCGGAGACACGTGCTTCTTGGGCGGGGA
CATGGGGGGCGGCGGGGGTGGAGGAGGGCTAATTGGAGCCTTCATCACTGTCGGAGGCAGCGGTGGGGTCGGAGGTCTGGACACGGACTTCCGGGATCCC
CCGCTTGCTCGCACAGGAGTCTCACTCGACGCCATCACGCCTCGAAGCTCCGACACGAGCTCCTGGGTCGTCAAACCCCTCGACCCAATAGCATCGGAAG
GCAGCGACATCGCCCTCGGGCCAGACGAGACCGATGAAGACGCGTCACCGAGGATCGAACTCTTCTCGTCGCCACGCTCGCCAAAGATCTCGAACACGCT
CTCGATTTCCATCTGCGCCGAGCGGTCTCGAGCTGCTTCGAGTCGCTGGCGGGATCGCGCTTCCGGCTCGGGTTCGTCGCTGTCGATTACTGAAAGCTTC
CGCTGCGCGTCCTCCAGGCTGCGCTGCAAGTCCCGAATCTTCTTCTCCAGCTCGTGGATTTCCGTGGCGCGGCGCACCGAGTCTGCAAAGTTGTGCGATT
GCGCGTCGTCATCGTCATCGTCTTCATGCTCCGAGCCGTCGTGCTCTGGCTGATACGTGGCCATGAGCTTCTCGTAGTTCGACGCGGAGTACGGGTCTGG
ACTCTGAGCCGAGCTGTCGTCGTCGCTGTCATACACTGTCGGGTAGCTGGCCACGGATGCAGAGCTCGCTGACACGCCGTCGTGGTCGTGCTCCTCCTGG
TTATTGTGGCCATTAGTAGCCTCGTGGCGGTCTCCTGCATCTGAGAAGGTGGATAGGAAGGCCTGGCCAGCCTGTCGCGTCGCACGAGCTGCAGCGAACG
TGATACGAGCCACAGAGTTGAACTGCTCGGCAGACATCGCAGTGCCATGGTCGCTCCCGCCGTCTCTCTGAGAGTCCTGACTGCGATCGCTGGGCCCCGA
GTAATACATGGCAGGAGCTGCATTCGTAGCGTTAGCCAGCGCAGCATCAAAGTTCGAGACTGAACTCTCCAGAGCGTCGCGGATACTGGTGATCTCGCTG
TACATGTCGTTGAACTCTTCGATCTCGTCGCTGTCCGCATCTTGACGTTCTCCATACGCCGCCTCGGACATCGTGAGGTTTATCGTGTCACGGACCTCTC
GAATATGAGTCACAACATCCGTCAGCGCCTGCATCTTGTCCCGAGCGCGCAGTTGCGGGCTGACGTTAACCTTGCGCTGCGGGTACACCGGCTTTAACTC
CGTCTCGGACGAGGCCTCCAGCACTTCCATGGCCAAGTCGCTCTGTCGACGGTCACGATCGCGCGACTCGCGCATCTGGAAAATCATGTCTTCGTACGAA
TTATGCTGCGGACTGCGCAGGCCGCGGATGTACGACTCGGTGTCGTTGGACGTCGACGACGCCGGT