Description :
From Genome Similarity Track
Location :
Scaffold_975:13682- 15610
Transcript NameFunction/comments
Phypl_g11887hypothetical protein

Sequence
1928 bases(100 bases per row)
GCACGCGATCACCTCTAGGGATTGCCGGATTGCGAGTCTCGAGTCTCCGACTATCAGCAGGTCCTCAGCTCCCTGGTCGAGGGCTGCTAGCACCCCATTA
TTCATACCGGTGTACTCAGCAAGGTTGACCGTTGTCTTGTCGAGAAAATCACTTGCAGCAATCACTATCTGCCATTCAGGAAGTCGCCATACAACCCACG
AGCAGCTGTCGTAGCCTCCGAACTTCTCCGTTTTCGCCGATCCATCGAAAGACACGACGAATCATCGGTCTCACGAGGTAGACGCGCGTACATCAGGTTG
GGATCCATGCGTACAGTAGGCGAACCATTTGCTGGCGGTGTCACCAGCGCGAGCGAGTCCTCAAGGTCGAGGAAACTTGTGATTGTCGACTGAAGCAGCT
GGGCGAAGACGCAGTCTTTCTCCTTGATGCGCTTAATCTTCAAATGCCATGGCGACAGCAGTACTGAGAATTGGACAGCGCGGCCGAAGAGCGACTTCGA
GCGGTGAACCCAGTCGAGCGTAGAGAACCGCGTGTACACACTGAGTGTCCGTCCAGCGAGCAGAGTGTAGCAAAATTTTAGCAACAGCAAGAgtgccagc
acctccttctcagcTGGATGATAGTTCATTTCTGCATCGTGAGGACTCGGCCGCAAAACCGGACGGGGTGTAACACGCCTTCGtgctcctgcaccagcgt
GGTACTGAGCGCCCACTCGTTTGCGAACAGCACTACGTGCACGTCTTTGTTCCTGTCGAAGTGCCGAAGGATAGGTGCATTAGCCACCTTCTGTTTCAGC
GTATTGACACTCCGTCGTGTGAGGTCACCCCCGGGACcaaagtcgtcgtccttgagTTGATAAAGCGCGGCGCCATACACAGCGAAGTCTTGGATGAATC
TGCTGTAGTAATTCAGCGCGCCTAGGAACGATTGCATGCCTTTTTTGGTTGTCGGAAACAAAAGCTCGCTGATAGCAGCCAGTTTTTTTCGGATCTGCGT
GAATTCCAGCTGGGGATATATGATGAGACAGAAAGTCAACCTTCGACTGGACAAAGATGCTATTCGTGAAACTGACACTGATTCGACACTCCTCAAAGCG
ACTTAGCAGACGGTCCAGCGTAGCCCAGCAGTTGTCGAATGTGTCTCCGCCGAAGCAGATATCGTCAACGAATGATCGTCGTTCGAACACTGGCACCAGC
GTGGACTCGGCCACATTTCCGGTCGAGAACATGTCGGCAATTGGGCTATTCACAAGTTGCGATACTGGATCCGCTGTTACCGAGGCAGCTCGGTCAGCGT
CGAACTTCGTACGATGGCTTTGTTTGGACATAGAGAGCGTCGGCGAGGTTTCGTTGGTAGCTCTTCGCAGGCTCGTCGCTTGACtctcagcagcttgcat
GAGTTCAGAGTAGTGTTTTCATCCGCCTTTCGGTTGGACAAAGACCCACAGCGCATTGTCGATCATGCGTTGGTATATCATCGGCGCATTCTTGAAGCCG
AACGGCATgcgcagccactcgaagtGCCCCAGTGCGCacacgaaggcgaaggccTTCCGAGCTCTCATGGTCACCATGATGGCCCAGAATCCGCTGGCTG
CATCCAAGGAGCAGAACCATAGGTAGGTCTCCATATCGGTCAACAAATCATCCACAAGCGGCATAGCGTATTCCATGATCGCGGTCACCGCATTCAGCAT
CTTGTAGTCGATGCATAGACGGATGTCCACGCCGTTTTTTTTAGGGCAATCACAATCGGCGACGTCCATGGGCTGTCCGAGAACGAAGTCAAACCAGCTT
TCAGCAGACCCTTCAGGAGTTCGTACAGTTTCTGTAGGTACTCGACGGGCACGCTGTTTAATCGGTGCATGCCCCTGGACGTCAATATCACAGATGACAC
CGTATGCTGGTAGGGGAAGCGCATTGCC