Description :
From Genome Similarity Track
Location :
Scaffold_923:13682- 14931
Transcript NameFunction/comments
Phyta_totarag11373hypothetical protein PHYSODRAFT_330016

Sequence
1249 bases(100 bases per row)
GTGCCGCGCCACCGTGAGCAGTCTGAGAGTTCGGTAATGCTGGTGTAAAGGGGAGTGGAAGGAGTGTATGATGGTATTGGTTTCTCCGCGACATGCACCC
TTGACATCAAATCAAATGGAGGCTGCATTTCGTTTGTCGCCCCGGCACAAACCGCGGCGACTTAGTTGCTACCATCCTAGGCAAAGTAGTAAGCAAGAAA
ATCAGAAAAAATGTCGTTCATGAGCTGACGCCCATCTTGATTGTGCTTCGTATTGTGGCTTCCTCGTCGGCGTGTTGAGATCGTTCTCCATTAGCACATC
ACCGCATGCTACGCAGCTCTGGCATCAATTTCTCTGCGGCACACGGAGCAACTTGGCAGGGTTTCATTTTTGATGCACCATCCTGACCACTTGTCAATGC
AAGCACAGTGAAAGCTGTGACCACAACCAACGGTAATGATGACGCGGTGACCACAACCAACGGTAATGATGACGCTGCTTTCCGTCGAGCCAAACTCGGA
CCAGCAGATCGTGCACTTGTCTGTTTCTCTCAAACCGGCAGACTTGGCGGTGGGTGACAACGTCACCGTGGTCGATTCAGCTCTTGGTTTGGCCACAATG
AGAAGACTCTCCCATTCGACGGAGCCATAGGATTTATCGGCATCGAAGCGATGGTACTTGCGTCCGCTTGCATCTTTCCATAGTGAAATGGCTGAAAAAC
AACTGCTCGCCTGCGTGCTGTCAAACTTCCACATGCAATAGTAAAATCCGCAAGTGCGGGCCTTCACCTTCGTGTGGCAAACCGGGCACTGGATATCGTC
ATCCCTCATGAGATTAAACACTTTGAAGCGCTTGGGATGTATAATCATGTCACGAAATGCAGCACAGGCTGAATTCTTGCATTTCCCTTCAATATTGAGT
CCTTGGTATGCAAAACGCCAGCCAGGGGCTTCTGAAGAGTACCTGCGCTCGGTCAGTATTGAATCATCAGTAATATCCGCGATGGAACCCCGCCACCGCG
CATCATCCGCACCAAATGCAGTTGGCTTTGATTTTTATTCCATAGGAAGAGAGCGTGAGATGATCTTCTAGTTGCTTGCCCCCATAGATAAGCCGCTGGT
GGTCCACAGGTATTTTTTCCTTGTTACGAATTTTCGCCTTTACGTAGCCCACGGGATTCGTGGACTCGCAAGCAAGAAGAATACTCTTGTTTGTGAGCGT
TTTGATGGAGATCATGATGCTCGTTCTGAGCACTCGGTTATATTGAACT