Description :
From Genome Similarity Track
Location :
Scaffold_6:1367974- 1373020
Sequence
5046 bases(100 bases per row)
GGTTATGAGCCCAAGGCTCACGCGTGGGGAGCACAGCAACTAGGACGTCATGGCGGATCAGAAGAAGACGCCCAAGGAGTCACACGAGGAGAAGAGGACG
ATCCCGCCGTTTAACGGCAAGGACTACGAGGTCTGGCACGAGCGAGTCAAGCTCAAGCTGGAGAGGAAGAAGCTGTGGAAGTACTGCATGGAGGACTTGC
TCGAGCCGGACGAGAGCAAGGAGGCAGAGGCGCACGCGACGTGGACGAGCGAGATGGCCCACGCCAAGGAGATCATCTACGACGCAATGACGAATCACAT
AATGAAGACTGTGAAGTATGAACCCACCCCGTTTCGTGTCATGGAGCGCCTGAAAAAGAGATTTATGGGCAAGACGTACCTGAAGTACGCTGAGGAGAGG
GCCAAGCTCAGTCGGCTACGGCTCGCTCCCAACGGCAATGTGCCAGATCACCTGAGCGAGATGCGTCGGCTGATGGAGACCATTGCTGGAGTCGGGCGTC
CTGTGGACGAGTATGTAAAGCGAGCACTATTGATTGGATCTCTGCCGCGCGAATATGATCATGTTGTACAGACGTTTCTCGCCAGTCACAAGCCCCAAAA
TGCTGATGATCCTCCTAATTATGAACAACTTGAACTCGCATTGGAGATGGCTTACGACCATCGCCAAGGTCGGAAAGCAGAGGGCGCCAAGGACAATGAT
GATGAAGAAAAGGCGTTCTTTGCTGGTGGAGGAAGAGGTCGAGGACGTGGTCGCGGCCGTGGACGTGGTGGTCGATCTGGAGGACACGGGCGCGGTTCCG
GTGGTGGACATGGTTCTGGCGGTCGCGGCAGCCAAGGTGGTGGGCGTGTAACTGGACGTGGCCAAGCCGGCAGTGGACAAAAGCCAGGTGGTGCTTGTTA
TCACTGCCATGAAGCAGGGCATCATGTGTTTGATTGCCCGTTTCTTGGCAACCGACCTCCAGCCGAGGATCGCAGCAGCACCCAAGCTCAGAAGCGCGTG
AAGATGAGTGGAGGAAAGAGTGCTAAGGCTGCTGAAACGAGTAGCTACGCTAATGAAAGTGATGACAGCGCGTATGTTATTCTTCAAGTGATGAAAATGA
AAAAGCCGGTCGCAGACAAAGCCCATGATAACTGGTACCTGGACTCTGGTGCATCGAGTCATATTTCGAACCAGCTCACTGATTTCATGGAGTTCACGCC
TCTAAGCGCCCGGATTCGAGTTGGAGGAAAGAACTCGCTGGGTGTTGAGGGTATTGGTACTGTGGTTAAAGAGCTGGAGACTACTGGTGGGAGGTGCTCA
CTGACGCTGCGAGGAGTTCGTTATGCTCCAGAGCTGCAGTGCAGTCTCTATTCTGTGCGACGGCAACTGAACCAATATCTGCCTGAACGTGATCGTGTGA
AGGTGCACTTTGATGAGGCAGATCGCGCTGATGTTATCTTACAGGCTGGTGTGACTACCGCTCAAGTTGATTATACCAATCTCTATCGCTTGAAGTTGGA
GAGACCCCAAGAGGTAGCCATGGTGGCGCTACCAGCTCGAGTGAGTAGTTTGGAGCTCTGGCATTCGAGATTGGGGCACCCTGGCAAGAACGCGTTTAAT
GCGCTGTTCAGCCATGATGAGTGGCCGTTGCCATATGTGAACTTGCGTATCCCGGTGGGTTTCAATTGCGAGACCTGTGTGACGGGGAAACTTACGAGGA
AGAGCATGAATAAGTCTCGGACACAGACCCGCGAGTGGTTAGTTGGCGAAAAGGTCCATGTGGACGCTTGGGGTCCACTCCTACGGTGGTAAACGGTACT
TTGCCGTGTTCGTTGATGATGCGAGTCGGTTTGTCACCGTGTATCTTCTGGAGCATCGTTCGGAAGTGTACCAAAAGTTTGAGGAGTACTATCAACGCGT
CAAGACGCAGCAGCATGTCAGAATGAAAGCGCTAAGGTCAGACAATGCAAAGGAGTTCAAGAAGCTGCAAAGTACGTGTGACACGAAGTATGGTATGGAG
TTTGACAGCAGCATCAAGCATACTCCGGAGCAAAATGGTGTCGCGGAGAGAATGGTCCGCACCATTACGGAGAGAATGCGATGCATGCTCGTGCACTTCG
ACCTGCCTGAAGCGGTGTGGGGTGAGGCAGCGATGACAGCTGCATACTCCGTGAACATTATGCCAAGCTCGGTTCGAGGCATGGAGGTACCGTATGCAGT
ATGCACCGTCAGACTCCTGCTTATGAGAAGTTGCGGACGTTTGGCTGCGCCGTCCTGTCGTACATCGACAAGGTGGAGAGACGGAAGATGCAGGCGAAAG
CACGGGAGGCGGTCTTCGTTGGATATTCGCGAGAGAAGCGAGGCTATCGCTTGCTCGATAGCAAGACCAACAAGGCCTTCTACAGCCATACTGTCGTGTT
CTATGAGAATAAAGCTGGTCGATTGCTCATGGACTCGGCATCAACGCCAAGTGGAGCCTCCGGTAAGGAATATTTAGGCGTTGATCGATCAGTAGAGGAT
GACATTGAGCCAATGCTGGATGAAATGCATGATGACTCAAATGATGGAGGTAGTTATCGTGATGATGGAGATTGCTGGACTGGTGGGGCCAGCGACTCCA
GAGACGGAGGTGATTATCGGACTGGTGGGGCTGATGACACCCGATGTGATGACCGACCAGGTGGGGCAGTTGAGCAAGATGTCCGGTCAGATGGGGCATG
TGGGTCCAAGAAGAGAGGCCCCGGTGGTGATGCCGCAGCGCCTCGACCAAAGAGAGTGCGGTTTGCGGTGTTTGAAAGTTGACGTTCTAGCAAGGTGGCA
GAACGAGATGAAGGACGTGGAGTGAGCTCTACAGCATCTGGATGTGATCGTTCTAGCAAGGTGGCAGAACGTGATGAGGAACGTGTCAATGGACATGAGG
CAGACCACCTGCGAGGTGAGTGCGTGCCAGGCAATTCCAAAAGAAGGAGAAAGAGGAAACGCAGCAGTGGGCGGCACAAGGGACCGGCTGCTGACGAGAC
GAGGGCTCTACCAGGGAGTCAAGAGGTGGAAGAGGTGGACAGCAGGTCATCGGCTGCTGAGCGGGCCGACTCGGACAGCCAAGTGTCGAGTGATGCTGCG
AGTGTGGGGCGTCTATCAACGCCTCCTTGCACAGCACTTCGTGAGTACACAGGCCCGAGAGGCACTCGCCATAAAGACCCTCCAGTGACACGGAGCGGTC
GGGTAAGTAAACCGCCCACGTGGTTCGGTGACTACGTCTACATTGCCTAAGAAAATACAAATCCAGATGACGATGTGAACTCGTTGCCTGCTGGATGGAG
GAAAGCACGAGCTGAGTTGCAACGTGCTATGGCGAACGAGTTGATCCTTGCATGGTGGGAGGACTATTGCTGCATGAGTACTGGCGAGTTTGAAGAGCCA
GATACTTTCGGTGACGCTATGGAGAGTGAGCACTCATTGCAATGGAAAAATGCAGCTGATGATGAGTTTGATTCGTTGATGAAGAACGATACCTGGGAGT
TGGTGCCGCGCGAGAAGCACGTGAAAGTGCTGCAGAATCGCTGGATCTTTCACGTCAAGTATCTAGCGAACGGAGAGATCGAAAGATTCCAAGCGAGGCT
CGTGATCAAGGGCTTCATACAGATTTATGGTATCGGTGTACTCGCCTGTTGTGAGGCTGGAGACACTGCGTGTTCTCTTGACACTGGCGGCTGTCTGGGA
TTATGAAGTGCATCAGATGGATGTCACTACTGCTTTCTTGAATGGGGCGATTGACGTGGAGGTCTATATGGAGCAGCCTGAAGGCTACAAAGTGAAAGGC
AAAGAGGACTGGGTGTGCAGATTGAAGAAGAGCCTGTACGGCTTGAAGCAGGGGCCCAGAGTGTGGTTTCAGCTGCTCAAGTCGTTCTTGGAGGAGCAGG
GCTTCACGATGCTGCAGTCGGAGGCCTGCGTGGCTGTTAAAGTAATTGATGGGCAGTTGGTCTTCATCCCTCTCTATGTTGACGATCTGATTTTGCTTGC
TCCGTCGATGGAGCTCATCAACAAGATGAAGAAGATGTTCGAGGACCGGTTTGCGATGAAGGATCTCGGGGAGTTAGACTACATTCTAGGCTGGGAGATC
ACGCGGAACCGGGCCGAGAGAACGATGTTCATTGGTCAGCAAAAGTATGCCGAGACCGTGCTCAAGCGGTTCAACATGCAGGACTGCAATGGCTGCAAGA
CGCCGAGCACGGCGGATCTGAAGCTGAGCAAGGCCATGTGTCCGACCGAAAACGATGAAAGGCAACTGATGAGATCGAAGCCATATCGTGCTGTGGTTGG
CAGCCTGATGTACCTGATGCTCGGTACCCGGCCCGATCTGGCCTACCTAGTTAGGGAGTGCAGTCAGTTCTTGGAAAACCCAGGTCTGTTGCATTGGAGA
GCTGCAAAACTTGGATTGCGCTACCTGAAAGACACAGCGGACTGGGGGCCCCAGCTTGGTGGCCTAGCGTGGTCAGATCAAAAGCTGGATGATCATCTGA
GAGCATACGCAGATGCGGATTTTTCAAATCGAGTTGATGATCGAAAGTCTGTTGCAGGCTACGTGACTCAATTTTGTGGGAGCATCATTTCGTGGAGCAG
CCAGACGGAGAAGACCGTCGCGCTGCACACGACCGAGGCCGAATATATGGCTCTTAGTCTACTGGTGCAGGAGGTGGTGCACTTGCGCCAAATGCTGAAG
GAGCTGCAGGTGCAGCAAATTCAGCCATCCCAAGTCTTTGTTGACAACGAAAGTGCAAAGAAGCTTGCCAGCAACCCTGTGTTTCATTCTCGGACCAAGC
ACATCGATGTGCGCCACCACTTCGTGCGTGAGCGCATCGATTTGAAGGAAATTGACGTGCTTCGGGTGCCAGGCGTTGATAACGTGGCCGATGCTTTTAC
AAAGCCATTGGCACGTCCGGCATTTGAAAAACACAGAGCTGCAATGGGATTATTGCCAAGGGCAAGATTTGGAGATGCAAGTTGATGGGAATCCGTAGGT
GGGGCTGTTGCGGATTATACTGATCCCCACTATACCACTTGCAGTT