Description :
From Genome Similarity Track
Location :
Scaffold_35:13679- 14771
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_35-snap-gene-0.34Aspartyl protease family A01B
Pytiw_DAOMBR242034maker-piw_contig_35-snap-gene-0.33Aspartyl protease family A01B

Sequence
1092 bases(100 bases per row)
GCTTGATAGGTGCAATTCGCGTCCGCGAAGCCGATGCGGTTGTTCCCGCTGTCAAAGACCACGTCCCGGTCCATCATGACGTTCGCACCGAGAACTGGGG
ATTTGCACAAGAGAGGAGAAGAAACACAGGTACAACCCCAGCTTTTGTCCAGCGCCAGCATGTAAACACAAGCAACCTTATACGCAGTACGTACTGCCGC
TACTGTCCTCGGTGAAGAAGAGTCCGCCGCAGGAGCGCCCGTCGCTCTCTTCAATGAGGTATTGCTGGGTCGTGAGCTCCAGCACCAGATCGTTCTTGCC
ATTCTCTGCTGCCTCCAATATAAAACGGATGACTGGGAAGCGCGCCACCTGCTGCTCCGAGTACCCAGTGCACGTCTGCGAGACGCCACCACCGCTGGAC
TCGTACGCCACCCCACTGAGCCGTTGGAAAGCCTCCGCAAAGGAGCTCTTCATGGAGATTGGGAGGTACGTGTACGTGGTGCCGCTGTCGATGCTGAAGT
GGCCGCGGGTGTAGGGAACTGAAGGCGCCTGGATGGATTCGTTGCCGATCTGGAGGTCATGAAGCTTGATATTGAAGAAGTTGCTGCGGGTCATGAGGCA
CGACATTGTCATACCGTCGCGACAATCTCAGTCCTGCTGTTAAGTATCAAAGTCTACGTACGTGTTGAGAGGATCGGGCCCGAGCTTGGTGTAGGCGATC
TTCCTAGTGTGGCGAGAGGTGTCGAGTGCGCCGAGGGTTAGAGAGCCACCAGTTGGCGTAAGGCAGAGCGAGAAGAGCTTCGCTGGGATCTTTTGCGCCT
TGTAGAGCTTGGCCACGAGCGAGTTGTCTTACGAAGTTCATCAGGACACTGGTTATTATCTCAGTAGATTGGCTAGATGACAGAAGGCACGCACCACTGT
TGGAGAGCCCCAGGAGGCCATTGACGCCTTGGACAGCAAACGCACTGGTCTCGTTGAAGCGACAGCCAAACATGAAGTTCGTGGCGAACTTACTCTGCAT
CACCTGGTCATTCTGAGTGGCATCGCTTGCTAGAAACAGGAAGTCCTCTGCGATTCTGGCCGAGTAGCTGGCCCCACTCGTGTACGCCTGGG