Description :
From Genome Similarity Track
Location :
Scaffold_304:13671- 18768
Sequence
5097 bases(100 bases per row)
GCTACTACGGACGAAGAAGAAAAATTATTACCGTAAGTAGATGGACTGATGGTCGTACACCCGTCATATCCAACGCCAACGCGCACTCTAAACCGACCGC
CGAAGGATATCGCAGAGACGGTCGTGGGAGAAGAGGAAGCAAAGTTTGAAGACGATATGCCGATATGTGATCCCGTGGAAGACCAAGATAAACTTAAAGG
ACCACAACCAGGACAATCGCCAGTGGTTATTAACGCGATCAACATACCTGGTAGGACTAGTGACGAGGATGACGGCGATGTGGTTTGTGATTCGGTGTCG
GATCAGCTGGAGCTAAAGAGTAAACCCCAGAGAGACATATCGACGCTATTACCAGCGACAGCCGACATAGACACCCCCGTTGACGTGATGGAAGACATTA
CGGTGGTGCGGGACCAGTCCTAAACGCAGCCAAACGAGTGCAAGGGGAATCTCACTTCCGAACCGATCAAGGATATGGTATCTGATCGTATGCAAGACCA
GTCCACCAATCACCTAGACGGGACTACTGTTAAGGATGGTGAGGTGCATCGACCGTCCGACCATCAGGTGAACCAGAAAGCAGCGATCACAAGCGAAGGA
GCACGCAAATGCTCGTCATACCAACGCGAAGGTGGAGTATTTTTCGCGAAAGACGTTGGCCAACACATGGCAGTCTTGCCAGAAGTAGACGTGATGCTGA
GCGAGGTAAAAATTGACGCCATACAGGTGGGCGATCCAGGGGTCCCATTGACCAAAGAGCAAGAGGAATTTTGTCAGCTGATCTGGAAGAATCGACACCT
TCTGATGGGCGAAGGAAATGCCCTCCCACCTGCTGCTCGAGGTGTAATCTGCGATATAGATGTTGGAGGAGCGACCCCAATCGCACAACGAGTAAGGCCA
GTCACCCCAAAGTTCCGTGAAAAGTTGGCGGACCTAATCAAAGGGTTACTATCGGCAAGAATCATATTTTCCTCAACTTCGCCATGGGTGTCGCCGATCG
TAGTGATCGTGAGACGAATGGGGTGAATATACGACTGTTTATAGACTACCGAAGAGTTAACCAATTGAAGAGGCTGATGGTATATCCCATGCCCCTGATT
AACGACTTGTTGCAGGATCTGGAAAAAGAGCTATGGTACTGTTCATTGGATATGGCCAGCGGATTCTGCTTTATGGAGCTGAAGAAAAGAGCACGAATGA
TCTCTGCTTTTATCACGCCCTCGGGTCTGTATGAATGGTGACGCATGCCGTTCGGTCTGAAGAACGCGCCGCAGATAGATCAACGTATGGTGGATAATGC
GTTATATGGATATCTTATGATCGGGGATCGGCCGAAGCCAAGTGACCACGAGGCTTCTCAACAGGCCGATGTGTTTACGGATGGCGAACTAAACCCGCAC
CGGAACCCTTCGGTTCTAGGAAGAAGGTCCTACGTTGATGACATTCTAATCCCAGTGTCATCCTGTACATCTCTCTATAGAAAGGTGGAAAGATTGTTGG
AAGTGTGTGATCAGTGGAATTTGTCGATCAACCTACCTAAGAGCGTCTGGGGATGAAACAAGGTTGAGTATCTCGGGCACCGAGTGCCAATAAAAGGAAT
CTAAGCTGACCCGAAGGATCTGGGGTCGTTGGTGAATATTCCTTTCCCCAGACACTGCGGTCAATGCAGCTCTTCCTAGGAAGCTTGAATTATTACAGCT
GGATCATCGAATACTTCACCATATACGCTTGGGTCTTGTACGAATTGAGGGAAGCTGATTTTCATGATATCAGGCGTTCGCACAGCACGGAAGTTGAAGG
CTCAACCATCTATGATCACGGCCATAATACCCATATTGATGATGACAGCGGGCAGCGACCAGCAGGTGATCACGATCATCCACTGGTGACAACGAATGGT
CAGGTTCCAATTAAAGTTAAAGCGTCCAATAGAGAACATACTGGTGCTCATCGTTGGGAGAAATCCATGATTCCGTTCACCATGTTGAAGGCTAAAGTAG
CCCAAACCCCGGTACTCAAACATTTCGATCCAGACCGCCGACCAGTGATCGTGGTTTACGCTTCCAAATGGGCGGTACCCGCAGCTTTGCTACAGGAACA
TGATGGATTGAATTGGCCTGTTATGTTCACAAGTCGATCGCTACATCCAAATGAAGTTTATAATGGAGCGGTAGAGAAGGAAGTTCTGGCCCTGCTCCAG
ATGTTGGATATTTGTTATACGCTATCGGACTCTCGGGATTTTGAGGTTCTCACAAGATATTCTACCTTGGCATGGTTAATGCATTCATCAGGTCTCAATC
GAAGACTTGGCAGATGGGCAGCTTTACTGTCGACTTGGACTTTGGAGATTAGTCGATGTAACAAAGGGGAGGACGAAATCCTCGGCAACCTCGCAGCGTG
TATTACACCGCGGAAAGATATGGATGAAATGTTGATCACGATCGAACCACGGAAGCAACCGAGACAGACTATCAGCACGCCTATCCCTACGATCAGACGT
GGCGAAGTGCTTCTGGTCGTCAGCTTTGACGGATCATCACGTATCAAGGAAAAGGGGGGCGCCTACAGTGCAGTGAAATGGAAATTGCCTGAGTGGACCA
TTTTGTCGGCTGCGTCGCGCTTCGACACTGGATTAACAGTAAACGAGGCAGAGTATCACGGGTTTCTGCTGAATTGCGACCTGCTAGTGAAACAGACAAG
GGGACGAGTGGTCATTTGTGGGGATTCCAACCTGTTCATCAGGCAGATGCAGGATGAAATTGATTGCAAAGCACAGGACCACAATTACTGCGTCTCAAAG
CCCTAGATCGACTTAGGTCGTGGCCGACACATAAGTTCTGACACGTCAAGAGCGATTGGAATCAAAGTGAGGATCGACCGGCTAGTACCGCTTAACAGTT
GGAAAAGAGAATGGTTATGCTAACTGATCAGGACCACCATGATCTGAGAGTTATCGACCGACTGGACGAAACATTGATGCCAGCGGGCAATGATCAAGTG
ATCACGACGGCGGTGATTACGCAATCGACCATGCGAAGGCGTGAGTTACTCATCATTATGCAAGAAGAGATAATACAGCAGATGCGACTCGACCGTATAA
AACAGGCTTAAGACGAAGAAAGTTGGATCGCCAACCTCAAACTTTACCTAGTCGGAGATGTTACGGAACTGGGTGCTACAGAAGCTAAAGCAAGTGCTGT
GATTGCCCCAGAATACGTGGTAGATGAAGGCGGATTGTTTTATCTCTGCCCACGATCGGCGACAAACCCCGCCGTGCTGAGCTCGTTCGTTTGGTAATCC
CGGAGTTGCTTCAAGATGATATTCTACACCACTACCACGCAACTCTATAATGTGGTCACCAAGAGGAAGGCCGCACGTATCATCTTGTGCGATCACACTT
CCATTGAAGAAGTTTGTTCAGAAGCGTGCAATAGTATGTGGGGAAGTGTGTCGACTGCGAAACCGGAAAGGGATGTCCAGCGCTACGAGGAAAATCCTCG
GGGAACATGCAAGCTAAGTACCCGTTCCAGATGATCGCAATAGATCATAATCCTTCTCTGCCTTGGTCATTCAAAGGAAACACTTGATTTCTTCTTTGGG
TTGATTTGTTCTCCGGCTACGTGATCGCTAAAGCTAGCTTGTCGAGGACGGCCCAAACGATCGCGGAAGGATATGTAGAATGCGTCTTCAGGCGATTTAG
AGCGAGCGAATCTATTCTTCATGATCGCGAACCTGGGTTTAGGTCGGGTTTTTTTGCGCATTCAACCGTATTGCCGGTCAAAAGCAGCGTGCTACAATGG
CATATCGGCCTCAGGCAAATGGCACCGCCGATCGGATGGTCCAAACGTTGACCAGGGCGCCAAAGATGTATGTCACGGACGTAAACGAACAAGGCTTGGA
TGAATACGCCGAGCGATTGACCTTTGCCATCAATACGGCGCATGACCGAGTTCGGGTTGATTCTCCGTTCTATCTCATCTACGGATGGGACCCGCGATCA
ACTTTGGAAGCAACCCTTGCGTTGGGATGCACCAAAACACGTGATCCTGCCCCTAGGAAATGGCGCTATCACATACAGAGACAGTTACAACGTGCCCGGG
CCACCGTGAATGACCGGCTGAAGGAAGCTATTTAGGACCGGGCTGGCCAACACAACAATGATCTAGGGCCACATGGAATAAGCTGTGGTAGCCAAGTGTT
GCTTTATTTGGATTGAGTGAAAGAAGGATATGCCAGGAAGCTGGCTCACATGTGGCATGGCTCATTCCGGGTGACCGAAAAGTGTGGAGAACATGCAGTA
CGGCTGGAAGTGCAGGGGACCCCATACCGATTGTTCCCGCACGTGCACATCTCTAAGTTCAAATTAATACGAAGTCTTCCTGAACAACCTGTTGCACGAC
TGGAGGTGGAAGAAACCGAGCGAGTGAATTTTGATGAAGCTCTACTGCCGGACGGTAGTTGGAAAGGCAATTTAGCCGAAGGGGAATACTAGGTGGACAG
CATTAGAGATGTGAGGTCGGTGCGAAAAACTCGGTACGGAAGAATACACCGACAGTTCCTGGTCCAGTGAAAGGGTCGTGATGATGAAACTTGGGTGGAT
GAAGCAAATCTCAATTGTCGTGCGTTGTTGCAGGAATTTAAACGTGGTCGAGCTAGACGGAATCGGTTTGAAGTGATGCAAGTACACACAAAGAAGAATC
CCGATGTTAGGGTGACCAGAAGTGCTTACCTCGACACGACGAATGGTGATCGTCTGGTTTGCGAGCGGAAAGCAACAATAACCACGCGAGCCGGCAAAGA
GGAGGATTTACATGGCTAACGAACGTAACGATTATGGAACGAAAAACAAAGGTGAATTGAGTAGTTACGACATGCGGTCACGACTGCAGCCACAAACACA
ATGGTCCTTTATACCAGAAACGGCCAATCACTTCTCTACGAACTTGTTCTTAAGGCGGTCGGTGGACGATCCCGGGTGATCAGCGATGGTTGTTCGGTAT
TGGCTACGCCAGGAATCTGGATAGGTCCGTCAGGCACAAGGCGGAGTCCAAATAAAGGATGTTGGATTGTCGGCAGTCAAAACCTGGATACAACAGG