Description :
From Genome Similarity Track
Location :
Scaffold_275:13670- 16585
Transcript NameFunction/comments
Phyag_g4199hypothetical protein PHYSODRAFT_498950
Phyag_g4200hypothetical protein
Phyag_g4201hypothetical protein PHYSODRAFT_560159

Sequence
2915 bases(100 bases per row)
agcttcgaaCGGATCAGCTCGAGAGACTTTCgctgggcagcagcatcaccttCATGCTCGAGCGTAGGAAAGAGCATGCGATGCTCATCTGAAAGCGGTG
TttgttgaagacgaagccgaagaTACTACGAACATTTTTAACGGCAGACAGAATGAGTTGTCGATCCCTCCATAAACCATCGATGCATAGCGTTCTTACC
TCGAgatgtcgctcttcttccagttgTTTTAGGCTGGTGCGCGTCACTTTATATGTCAAAGcacgctgcaccagcagatcAGGAGTAAACACTTCCTCCA
GACCCAGTTTGGGGTTCTTGCGGAAGAACTCGCTGCACTGTTCCAGGTCCTATTATCACGACAGTCAAAGATATTCAGTGAGATGTTGACTATCCAGCAT
CTTAATTAAAGCTACCTTACCATTGCGAGAAGTTTTGGACGCAACTCCGCGGTGATGGCAAGAGCGACACCATACACAGCTTTCCACCCATCCATAAAAA
TGAGATCCCAAACTCTGACAAGTGTGGGGATGGTTAGCACACGAGCAAACACCGTCACAAACCACTacgaagcaggagaaaacACGTCAGTCACACCACT
TTTGAGCGTAAGAGCGCCAATTGATGAAAACAGCTGCCTACCTGAGTGACTAGGATACTGGAATGCATCCCGATCTGTCGGAAATGCATTGACAGGTCGT
AAAAGTGAATCTTGACAAGCTGTTGAAAGAGATAAATACACTGTGACAGCCTACGACACGGTAACAACGTCAGCGAATGAGCCAATTGCAGTCTCAGCAA
CAAATTCTCGCAGGACGTACCCTGGCATCTTGTGTTTCCACAGATCAGCCATCCCCTTGCGGCGAATCAAGGAAAGAGTCAACCAaaacgctgcttcttg
tacgGAGAGTCCGTCAAGGTCAAATTCCAGATCTTTCATcacgagcagaagcgcagCGACAACATAATTCATCCCCTTCACAGCGCAATAACCACGTCAA
ATTTTTGTCGTCAGGAATTCACCAACACTGCATCCCACCGCACCTGGCAGTAGCCAACGTCATTTGCATGTACAGCGACTGCTTTAAGAACAGTCCCAAG
CTGACGTCTACCGTCGCCTAACCAAACACCACAACAACCACGGTTACCATCACAATCTGCTACTCATTTTTCACCGCTAACAACCACTTCAGCACTGACC
TTCCTCCGAAAAGAAAGGGTTCGCTGGAAACGTGCGCTCAATATCCCGATCAATTTCTCCTAAAAAAACAATTAGCCATCTCTATTACCTCCTTCACCCA
ACACCACCTCTCACCTTCCACTCCGGTCGTCTCCAACACCGCCTTGTCCTCCAAACTCTCAATCTCAGCCAACTACCCcacaaaaaaaaaatctcATTAA
CCCCCCACTCCTCATCTAATAAAACACCATCATCCGTCTACCTCGAGGTACAATTCTCTGCTGGTCAGTTGCTCTGGGATCTCCTTCATCAGCGTCGAGA
CGTCTCCAGCTCGCAGCCAGTAGCTTCAACAAGGCAAAAAAAAAGTCACTTCCAGTATCTTCGCCCTGATTAACGACTGCATCCCTCACCGAACTCGTGC
CTCCGCAGGGAACCCACCGACTCGAACTGCCTGTCGTCGCAACTTCCCACGCTCCACTACGGCCTGCAATGATTTATTGACAAACGCAGCGGCCTCCACA
GCCTCCACCTGCAGAATTCAATACGTACAGACGTGAATGGGATATCGTTGCAATGGAGAGAACGCGGCGCATCACCTGCACCCATCGGTTGCGAATGAGA
ATGGGGAGAACCTCCCCAAACAGCGTGTCGAGCGCAGCGTCCGGCGTCGATGGGCTCATTGTTTTTTCGTCAAAAAATGCAAAATATTAGCAATTACTGA
AAGCAATTGTGGATATGTGGTGTACATACAAAACCCAAGATTggcaaacaaacaaacagaTCTTCCTCTCTTGATGCAGAAGCGTTCTCTTGCTCGACAC
TAAGTACTGGTCACGACCGAATGAGAAACAGGCGCCACTATTTTNAATTCGCCCACAGCAGGTACTCGTAGACATCGTGGCAGTGAATATTCCACATCGT
TTTATTGTCCGCCAAGATCATCACCTGGACCCCTTTtgccttggccagcgccagctgaATGGCAAGCTCTAGTAGCGTAAAGTAGAACGCCGATATGAAG
ATAGAATAGTGAGCGTTGCCGATATACTTGCACAGCATTCGTTTGAGTTCAGGGGTGCGGCCGAAATACGACTCGTGAGTATCATGGTGGCGGAGATCGA
TCTCCACCAGGATCTGTTGACGATGCACAGCAACGACCCGCTCCTTGCACAGCTCGGCGgtgtcggcggcgtcgcaaacttccacctccttcccCAGTTT
CTGAAGTGCggacagctcaaagcgatccGCCAGCTCTAGGACAGACGCAGCCTTCGGGCCGCgctttggcgttggcgttcccctcgcgtcgaagcgccTT
TTGGCCACGACCtcggagcagcagtagcatcGCGCCAGTTGGAGCCTGTCCTCCTTCGTGAGTTCCACCCGAATTTACTAGTAAAAAAATATCGGTTTAA
AACCGACCCGTATTTACTTTGACTCAGTTTTTAAAAAAGCACCGGCCCAAAAAAAGTtagcgacgatgaaggcgaacgcaggcgtcgtcatcgtacGGCA
TAAAGCACCACGGGTTGACTGCAACTTTTGTCTAAATGGTATCTGTTGTGTTGTTATTATTGCAGACTGGAgagaaggtgacgctggtgccgtacgagaa
ggagcatGTGCCAAAGTACCACAACTGGATGAAGGACCCGTGGCTGCAAGGTAAGCTATGCAGTGACTGTGAATTAGTGGTGGTATCGACCTAATActat
tttattttattttta