Description :
From Genome Similarity Track
Location :
Scaffold_109:136685- 139996
Transcript NameFunction/comments
Physo_142176hypothetical protein
Physo_158488hypothetical protein

Sequence
3311 bases(100 bases per row)
CAACTGATTCAGCGACTGCTTCTTGGATCCTCGATGGAGAAGACTCGCGAAAGAGCACATTGCGCACAGTTTGCTGCACCAAGCGCTCGACGATGTCCCT
CGACCTCGTCATGGTGCCAACTCGGCGAGTAACACAATGACGATCTTCGACCAAAACAATCGCAGCTTTCCTTGATTTAGCTGGAAGCGTCAACGGTCGG
TCACCACTTTCGACCGAAAAGATTCGCTACAACTTAGCACACGAATCCAAAGCATGTCGAAGGCTCAGAAGAAGGACGACGTGTCTGTGGGTGGGCTGCG
TATCGTGTACCAAGACACGTCCAAGGAGCTGGAAGAGCTCATCCTCTCCAGCGCCACCAACGCGCTGAAAGCTCTGTACAAGGGCGAGAAGAACCACTTC
ACAGAAGTCGCTCAGCAGATCAAGCACGAGATCGAGGAGTCGCAGGAAGGCGCGTGGCACGTCATCGTGGGCAAGTCCTTTGGCTCCTTCGTCTCGCATG
AAGTCAAAAAGTAAGTATACGAACACAGTACTATTGCCAATGTCGAGGAACGTTTACATTCACCTTCCCATCATCGTCCGTAGGATGCTGTACTTCTTCC
TGGGTCAGATCGGCTTTCTCGTTTATCGACATGGTTGACACAGCTACTGGATCTGCATTCACTGCTGTTAAATAATCATCTTTGCCTACATTTTCTCTCT
GTCTCCGCTGCAATCGCATTCAGGCTCCGTCTCCGATGATCACCAAGTCAACGCGCCACTTGAGGAGCCTTCTTCGGCCTAAAAAACTATCCATATTGCC
GAAATTGCTCCTACTGTTGCTGTTGCTGTTGCTGTTGCTGCTGCTGCTGCTGTTGGCGTAGTATCTCCACTGAGCGTTGGAACGTTCTCTTCAGAGACTC
GCGAATATTGCGACTGAACTGCACAACCCGCACGATCTCAACCTCGCGCTCCTTCTTAAGCTTCATGATACTCTTCTCGTGCATCTGGATGTTGGCGCTC
GTTGTTCGGATCACTGTAGTTTCCCAGCTCGAGCCAACAGCGCTGGACTGTGTCAGCGTCTCACTGAGCTGCTGGTTCAGCTCAATCAGCTTCTTCTTGT
GCTGGTTGATCTCGTTGGATATCTGCAGACACTTACGGTGGCTGATCATGGGCACCTGCGGCACATCGCCCAGCTCAGTCAGACGCAGAAGACGCACAGC
AGCCATGATGTCGTGGGACTGGATAATCATTGCGATAAACAAATTATCGCGCCGATTCCGCTCTGACGTCAGTACAGGCTGCAGACTGGTGAGCCTGGCC
ATCAAGTTCCCTGCCGCGAATGGCCCTTGACATGTTGCGACGGCGATCTGCCTGGTCAATTGCTCAGTCTGTAGCTCCAAATTAGTCACGGTTTGGTTCA
CCTCGTGATAGCGGTCCACTAATGAGTCGACCAGCGCGTTCTCCGCGAAGACAGCGCCGCCAAGCGGCAGTAGATTGGTCGGGTTGGACGTGCTGGCCAA
ATCTGTGCTAATGGCAGAAGTTGTTGACCACACTCCGTTAGCTGAGTTCATAGAAGTAGCTGGGGAGCTTGATACTATCTCCATCATACCATTGCTTGCG
GTACTCGTCACGTAGCCCATACTTCCGGTTGAAGACCCCATTGACGACGCTGATGCGGCGAACTGAGGTACGCTGGTGTTCCACTGCATATTGCTCACGC
TGGTGCTTATGTTAACTGAGTTGCTCCCGTTCAGCATTGATGACGAGTTGTATGGCAAGCTGGCTTGCACAGCAGGCGACGGTGCTGCTTCTGATAGCCC
TGGAGGGAACGGAATAGGCTCAATCATCGAGTGCTGAGCAACTGAAGGCTGAGCAGGTGCAACTTGGAGTGGCACGTCCAGTTGCGCGAATACTTCACTG
GGACGAGTAAGCACTTGCTCAATTCCACCGCTTCCAGTATCGTTGCCATTCTGAATAGTTGCAGCGCCACCGCCATCAATCCGCGCCTCGGAATTTCCAT
TAGAAGCAGTTCTTGCACTAACCGTATCGTCGTCATCGTCGTCGTCAATTACAATCACCTCCACATCGCGCTTCCGCTTTCCACCAGTAGCTTCTCTTTC
AGAAGTATCAGGGCTTGAAGCTGGGTGTTTTCGCGCCGTAATTAATTGCATGATTGCGTTCTGGAACGGTGTCGACCAATCCGATTTTGCCAAGCAGGTT
CCGGGAGCATCTGTGAATGAGAAAATTGCTCGAGGTTAGTCCTATGTAAATCAACGTTCGGGGGTACTGCACAGCATTACGGACCTTCCGTGGCAAGCTT
GCGGTGGTGTTTAACCTTCTCCACACTATGAATCTGGTCAAAGCAGGCTCCGCAAAACTTCAGATCGCACCCCGCACACCAGTACGCAATGCGCTCCAGG
TGGCACTGCGGACAAACTGCCACAAAAAAATAAAAAAAATGAGGACTCTTGACTAACAGCAACAACAAAAATATTCTCCATAAACTCACTCGACGCAGGG
AGTTGCCGATGCTCCTTGCCCTCTTCCTTGTGCGTGGACTTCCAGCAAGACGAACACAACGGCTGGTCCAGCAGGACACAGCCTTCCTGTCGACACTTAA
TCTCCGCCTTCGTATTTCGCTTGCATCGAGTACAGACCGAACACCTCGGCATCGTCAGCTCTACACATTCAAACACACCAAAGTCGTTAACGGTCATACA
GTGCAACTTGCACCTCTCCAGAACACTTTACGTTTGATCTGCTCTCGATCATGGCTCTTGAAGTTCTGCAGCACCATCGGGATGACCTCGAACCAGCGCT
TTATCTTCTTGTCAGGCGCTGGATCCTGCTGCCCTACAGGTGCAGCAACAGCAGCGCCTCCGCCTGTCGCCTGTCGCGCTGCCACGCCGTTCTGGCCTCC
ACTAGCGACCGAAATCGGTCCGTTCCGCTCTGTGTTGCCGCCTTTCTCGCTCTCTGTGGGCGTCGGCGCTGCGTCGCTGCCTGACGAGGCCGTCTCTGGT
GTCATGGGCGAGTCTTGCGCCTTCTGCTGCGCTTGGGGCGCCGCGGCGACGGCAGCAGATCCGCTGGAGGTCGGCTGATGAGACGAGGAAGACGCCGCTT
GTGCGCCCTGTACAGAAGCCGCCGAGGGCTGCGCGAAGAGCTGCTCGATGCCGGACGCTTGTACGGACGTCTCCGCTCCCGCAGAAGTCGCAGAGGCCGG
CGGCGCGGCCCCTGAGGCCCCCGCAGCGCGCGCGCTTCCCTCCATCCTTTCGCGCCGGCTCGAATGAACTTAAATGGGGTCGTTTTAATTGAAGCAAGAC
ATACTGAAAGC