Description :
From Genome Similarity Track
Location :
contig_51:13662- 15467
Transcript NameFunction/comments
g10097.t1hypothetical protein

Sequence
1805 bases(100 bases per row)
AAGACATTAATCCGTTAGCCGTTCAGACAGAACGGCGGGACCGAATATCGGCAGCACAAGACGAAGAATGCAAGTGGTCAAACCTGAAACAATACCTACG
AGGTGAATTCGACGAGCTCACTCGACTAAGAGCAGGAAACGCAGGCAAAGTTGCTGACCGATTCGTGCTCAGCGAAGATGGCCTACTGTACTATCTGGGT
CGCCGACGAGAGCGAAGAGAACCCAGCGAAGAAGACATGAAGTTGAGACTGGTAGTTCCGACCACGCTCATCGACGAAATCTTAGCGAATTGTCACAACT
CCATCGAGGGAGGACACCAAGGAATCGTGAGAACGTATCACCGAGTGAAGACAGACTACTATTGGATCGGATTGTATGCCGATGTGGTCAAGCGCGTTCA
AGCGTGCGAAGACTGCAATACCAGCAAGAGCAAACCCCACCTACGAGGGTATTCGCCTGGTAACGTAGTATCAGACAGACCATTCCAGATCGTGTCCATG
GATTTCGTTATTCCACTGCCAAAGACTCAGCGAGGGAACACTGCACTGCTCCTCTTCCAGGATCACTTTACTAGATTCGTGATCGACAAAGCAATGAACG
ACACAGGGGCACTTGAAGTGGCAAAGGCATTTGAAGAATGCATTTTTCGTCGGTTTGGAGCTCCTTCGCTCCTTCGACACGATAGAGATCCAAGATTCAT
GAGCGAAGTTTTCCAGACGTTTTCTGAGATGATGCAGTCTAGGTCACGAGCCACCCTGAGTTATCGACCTCAAGCAAATGGTCAACAAGAGCGTAGCGTC
AAGACGATGATCCAGACAGTACGCGTCTACGTAGAAGACCCGTTACAAGCTGACTGGGATGACATCGCAGAAAAACTCGTCCACGCTATCAACAACTCAA
GAGATTCGACTCGGCGAGAAACGCCAATTTACTTGGTACACGGCTGGGATGCTCAGTCTACACTCAAATCGATGACTTTGTCCATTCGCCGGTCCTCAGA
GAGCCCAGCGAAACAAACGACGTCAGCAAACGCTATAGAATGGCGCAGAGAAGCAAACCGGCAGCGAGAAATCGCGCTCATTCTTGCCAAGGAATACCAA
CTGAAAGAAAAAGCCCGGTGAGCCAAAGAGCATAATGAGTCGTTGAGCCGAGTAGAGCAGGGAGCTGTTACTTGAACGAGTAACGAAGACAATGGACAAA
TAGACGAGACAAACTCAGCGAGAGACGACACAGCCACTGCAAGCGCGAACAAAGAATTAGCTGAGCCCACACGGTCGGCTATTCAAAGAAGGAGACCAAG
TCTGGTTGTTCATGGAACGGGTGAAACCCGGATTGAAGAAGAAACTTGCACACCGATGGCACGGACCTTTCCGGATCAAGCACAAGGTAGAAGAATTCGC
TTACGAGCTAGAACTACCGGACAAGAGTGGCTATCGATTCTACCCCGTGGTTCATGTATCTCGACTGAAGAAGGTGACTGAGCTCAGCGAACGTCCCACG
ACTCAGCTAGTCGATGGTCTCAGCGAAAACGATCGATTTGACTTCGACGAGGAGTTGCTGCCGGAAGACAGCTGGGAACCTGACGAACGAACCGGGCGAT
ATGAAGTAGAAGCCATTCTCGATGATGAAATGCCGCTTTCGACGAGTACCGACCGAGCTCAGCGTCTGTTCAAAGTAAAATGGGTGGGATATGATGAACC
CACGTGGGAACCCCTGTCGAATTTATCGTGCGGAGGCCTTCTGTTCGATTACCTTCGCCAAAAGAAACGTGAAAACTGTATGCAAATGGTGCAAGTTGCA
AACGA