Description :
From Genome Similarity Track
Location :
Scaffold_2158:1366- 2700
Sequence
1334 bases(100 bases per row)
ACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAG
ATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCC
GTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGT
GGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTG
CCTTGCGGGTGTGTTCCCTTGCCTTTGCGTTCCTTTGCGTTGTACTTGCCGCCTCCTATGACGGGATCTTGAGAGTTGAGAGCCCCTAGGGTGTAACCGA
CCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACAAGTAAAGGAAAAGCTCACTAGGTTGTAGGATCTGGCCAATGTATTATCCAGTTATCACTACC
AACACTAGATTCGCAATTCCCAACCTTCTCGGAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGGGCAGGAAGGCACTTGCGTGTCACTGTGCAAATT
GAGGACTGTATTGATATTTAAGCCTATACCTGCCTGGGTTTCTACCTTCTATGTCTTTCATCTGCTAAATCCCTTACCAGGCTCGGCTGCATGTCCCTTC
TTCCCTTGACCCATCATCCCAGCTGTGTTATCTTCAGATCCACCGGATATATGACGTAATCATCATGGTCACCCTATTATGGGTACACTCATCCGGATCC
AGGTCGCTTGGATCCACCTCACTGTAATGGTACACTCGCCGTGGATACGAGCTCTCCAATCATCCAACATCATCTCGCAACCGTCTGTGATCTCCATTGT
CCCACGAAAGCTCTAGATCCACTGCATCCATCATACCTATACCCTGGATCCAGGTCCCTTAAGGCGGGATCCTCCCTCCTTGGATACGAACTCAGAAGTA
TGGGATCCGGGGTACCTCGCGGTGGATCTTGACTCTTCATTAGCCGTGGCTACTAGATCCACCGTCAGAGGGCACCGACCATCCTTCCTTCATAGGATCC
ACACTCGATCCACTCTTGTATAGTATATCCCATATCCATCTTAGTGAATCCAGGTAAGGGTGGATCCGAGGTAAGTCTTGGTGGATCTTGTCTTCTCGTA
CATCGCTCATATCAGATCCATCGTCATTCCATAC