Description :
From Genome Similarity Track
Location :
Scaffold_653:1366- 2565
Sequence
1199 bases(100 bases per row)
AATACGAACGAGGGCAAGTGAACCTTCCGATGGACGGAAGCCCgactgcgtctgcaacgcacattgcGCGTGCAGACTACCCCAACATGTCGAACTCAGA
GTGGGAGGCGCTCCAACGACTGTCAACAGTCCCTGGCGAGGCGGCTGTAacggcgatgctgcgcacgcGATTACCGACAGAGCAACACTATTGCTCTCGG
CTTTATCGTTAAGGTGCAgtgagatgctgctgcgtctaCGACGGTGTCGTCCTCAATGACACCGCGATCGCTGTCGCAGATTCTCCACGTGTGCAACTAC
GTGGGAAAAGAGGGTGAATCCTTCTCCATTGACTTGCCGAAGTCGACACAGCCATCACGGCTCAACGTATCGTCGACCTGTTGTCGAAGGTTTCGTTCGC
TATGTCGTGCCTTGGCGGACGAGCCAGAGTTGGGCGTTCGGACGCCGAACGCGGACCCTAcgtgcttcagcacgtacCAGGATTTCAAGCAGGAGCTCAG
ACGAGCGTTTGAGCCCACACAAAGTGAGTTCCGATCGAGCTCAAAGTTTCTCGATCTGCAACAGGGCAAGCATGACGTTCATGCATACGCACAAAGGGCG
CCGTACTTTGTCTCGAACATCGCGACCAACCCGATAGACGAGGCGACTAAGATTGTCACGTTCATGAAAGTCTTGAAGGATGGGCCGGTCAAGACTTATT
TTTTTTTAGAGTACCCAGTACTCTCGAAGCTGCAATCGCGTTCGCAATCCAAGAAGAGTTTAGTCTGCGGCAGGCTAAACTGCATGGTAAGAACGGGAGG
TCCGGAGCCAATGAACCTCTCGAACGCGACGACTGGGAATAACCCACCTCGTCGCGGGGTGGACGTACGATGATTTCCTTGCGGACGCATCGGTCATTTT
GCGCGCGAGTGCGCAGCACCGGTGCACCGACAAAGGAGCCAACGTGGCGATGTCGGGCACCGTCACAAAACCTAAAAAACGGGTGGAACTGGGGCGCCCT
ACTGATGAAGCCGTCACGCATGTCGACATTGGACACGCGTCAATGAGGACTGCACCCCCAGTGAGAAGCATTCTCACTGCAACAAGCGAGATGACAGGCT
AAACCTTGTAATCCTGGACGTGACTTCGAAGAGAGCGGGCTCTCTTCGTGTCTTGGTAGACTTAGATGCGTCAAACAACTttgttcgacagcaaagCCT