Description :
From Genome Similarity Track
Location :
Scaffold_109:13659- 29339
Transcript NameFunction/comments
Phyag_g2173hypothetical protein PHYSODRAFT_284561
Phyag_g2174hypothetical protein PHYSODRAFT_476772
Phyag_g2175hypothetical protein
Phyag_g2176putative RNA helicase
Phyag_g2177putative RNA helicase
Phyag_g2178hypothetical protein PHYSODRAFT_472499

Sequence
15680 bases(100 bases per row)
AGGAAGGAAGCCAAAGTCCTCCAACATCAGACGGAAGCATGGCTGGAGGAGGTACGTACAGACGCTCAGCCTCCGGATTGTCTGTGCCCAGCTGATTAAC
CTGCGTCTCCTCTCTCTGTCGATGTCCGCTTCGCCACCCGCAGTTTACTTGTGCGGCACGATCGTCAgcttcgtcggcttcgtcttcctgGTACAACATT
TCAGTGGTCGACACTGCGCTCTTCAAGCGAGCTATAGCCGTGCTAATGATGTTTATTATTTTGATATGACATTATATTATTGCAGGTAGCGGTGGGGTCT
CTCCTAAAACTGCAACCAATGTACATTCACAACGCCAAGACGCCCAACTCAGGCGCCAACGCGTGCTTCGAAGCAGGTGCGTTCTGCTCTAAGCTTTGAA
GCTGTCTGTACCTTTGCACTATTGCAGACACTGTGTTGTTACGATGCTgacttgtgtgtgtgtggatTTATTGTTGTTTTTGTCTGGGTGTTGCGTGCGG
CTTGgaattattttttttattgcTGGTGCTCAGCCATGTTATATGCCGTCGCGTTGGTCGTGTGCTACTCGCTGTGGCGGAAAGAGATGCTGCGCTCAGG
CGAGATGGACTTCCTCTCGGACACATTTACACACAAGCGCGACAGAGCCTTCTACGGCTCcgaagactcggacgaggagctgccgttggcgaagaacatG
TCTCCCACGCCGCGTATGGTGTAGAGTCTGCTTGGAAAACCCCGTCGACGTCAGCCCAGCGATGATATCTAAAGACCTACAAGTGTTTGCATAGCCCACA
CTGCTCGTATGATCGTTTTCTTCGGTCGAACTAGTCGAACTTGGTCGACTGGTGCGACCCGTCTTTTTCTAAGTCACATCCTGTCACTTTTACCTTCGTA
TCCACAGTACTCCTATTTCATGTTCTGTCCACGAAGAATCCTTCCCCTCACCCACCGGTATTTAGATCTCAGTAGCTAAAGTTCCCTATCCTTCCGCAGG
TATGAGCGACTGGCGCCCTGCAGACGCTCCAAAGCCCACGCCCACAGGCTGGGActcaagcgacgacgacgagttctcgACCTCTCGCCAGCAACACCAG
GAGCACGTCGCTTCCGTACTGACGCAGCTGCCGCGCGCGTCtccagacgacgaagacgcagccaccgccaccagccCCAGCGTGCAGTCCACAGCGCTGA
CCACGTACAGTTCGTCAGGTATCGAAGGCCTCTACGACTCGCCAGGCTACACGAgcaacggcggcagcagctacagcagctcGGGGGGCTACAGTCGCGT
CAGTAGAAATGCCTTCACGGGGCTGTCCAACCAGGGAGCGACGTGCTACATGAAcagtctgctgcagagcatgTTCATGACGCCGGAATTCCGCCAGGGA
CTGTACAATTGGACGTGTCACAGAGAAGCGAAGAAGGCAGAAGAGCAGATGGAAaaaaaggaggagaacgaagacgaagaaagagaaaatgaagacgaag
aagaagcagacgaagacAATATCccgttgcagctgcagaacctCTTtgccaagttgcagctgaCGACCCAGGACTCAATTTCCACTAAAGCTCTGACCAA
GAGCTTCGGGTGGACGGGCGCTGATgtgttccagcagcacgacgtaCAGGAGCTGTGCagagtgctgctggatgcactgGAGAGATCTTTCAAAGGAACC
GTGAACGAGACGCTGGTGAATGATTTGTACCAAGGATCGTTGAAGGATTACGTGCAGTGCTGTCACTGTAGATACGAGAGCTCGAGGATTGATAATTTTC
TGGATTTGTCGCTGGTGATTCGACCGTTTGGGTCCAcggagatgatgaagacggtggaggaggctATTGAATTGTTTTTGAGGCCGGAAGTGCTGGATAA
AGAGAACCAATGGATGTGTGACAGGTGCAAGGAAAAGCGAGACGCGATTAAGGGACTCAAGTTCTCCAAACTGCCGTATATTTtgatgctgcagttgaag
cgctttGATTTTGACTATGCTACGATGAACCGCATCAAGTTGCACAACAAGGTGACGTTTCCGAAATATTTGGATATGAACTCGTACGTGAGCGATGAAA
ACGGTGGCGTTCGTGGCAAGATTGCTAGAAAAATGTCGATGGAGCGTCACGAGTTGGAGGGCAAAAACCACCATAATTCGCAAGATCAAGCGGCAACAGC
TatgtcttcttcgcctcctcTAACACCAGGACTCGCTGCTGTGAGTGAACGAATGCACCGCTTGTCGTCTATGGACGAATCACAGCCGATGACATTTGTA
CAAGAcgatgagaaggaggacgacgatgacgatgacgatgacgatgaggatgtGGATGGCACCACTTCGTTTGACACGTGGAGTCCCACTTTTGACCCGG
AGGTCATGATTAAGCGCTCGGGGCCGCACGTGTACGAGCTGTATTCAGTTCTCATTCACTCTGGCAGCGCACTGGGTGGGCACTACTACGCGTACATTAA
ATCTCTAGAGAGTGGCAAATGGTACAACTTTAACGACTCCACCGTGAGTGAAATTTCAGACACGGAACTTCAGACAGCATTTGGAGGCGCAAGTGGCTCA
GGATACAACATGCGTTACAGCACTTGCGCGTACATGCTCCTGTATCGTTTGGTAAATTCGGACAAGAATGTGAATGTGATCCTGCCAGAGAGTATTCCTC
AGTATTTAAAAGACAAAATCCATGCTGACGAAGACAAGATTCGAAGGCTTGAACAGGAACGATTGGAGATGGCCAAAAAAGTTCAGGTGAAGTTTTTCAT
GAAGGGCTCTAAGCCTAAAAATTTAGAGAAAGTCATCTACGTATACAAGACCTCAACGATTCGTGATGCGCTCGAGACGGCTTACAAGGAGTTCGCCAAA
GAAAAGGATGTTATAGTCCCATCGATAGAGAATGTGCGACTGCGCGGGTACAACGACTACAACTGCCTGCTGTCTGACACGTACAACGACAAGGAAGATA
TGACCCTGTTGTCGTTGGGAATTTACGCAGGCCAACAAATGTTCCTCGAGGTTaagagcgacgatgaagtaTGGGAGGAGCATGACCCGACTAAGCTTCA
ACTCTTCGTCCGCCGATTTGTTGACCCGGAACCTGACGACTCccggaagagcagcaagactCCCGCTGGTGTATTTATGGCGAGGTACGTtcaggtggac
gaggaagcgGACGTTGGAGCACTTTGTGCACTCATTGCAAAGAAATTCTCCATTCCAGCTGATCGGAAGATTCGCCTGATAAAGAAGAGTGCAACCACAT
ACAGCATCTCCGCAGCCAAGATTCTAAACGCAAATGGCGAGCAACGCACGCTAAACCTGCGGCTGAAGATGGATTTGCACTTGATGAATGGAACTGAGTT
GTATTTCGAGGAGACACCAGATCTCACGCTTCCATCGCCTGCTGAGTCGTTCTTTGAACGCGAAGCAAACATGATCACGGTTAATTTCAAATACTTGAGC
AGTCCGGCGGAGCCTATTCGCATCGACCGAAGAGAGACTATCCGCACGTTAAAGGAGAGGATTGGTGCCAAGATTGGTCTTCCCTCGAACAAGTTTAAGC
TTCTACGTGGAATCAATAGCGCCGGCGTAGAAATCAAGGCAATTGATAGCACACTCTCGAAATTATCGATTGGCTCCAACCACACAGTCTTCGCCTTGGA
GGGCACTCCGCTGAATACGGGTGAGTACAACTTCCGACTGATGTTTTATAACCCGACAAACTCCACTTCGGTATCTCCAGAGAGCAACGATAGGAACAAC
CAGGATCAACCGACCATGACGAATGCGGATGCCGATGGCATTGAGGAAAAGTTTGATATCGATGAGGTGCTAGTGACGACAGGAAAGGATGACTCGTTGC
TGACATTTGTGAGTCAAGTTGTTATCAGCGAGGAGATGCTAGTGGAAGATATTCGTAAAAAGGTGTGGGATCaattggtggagaagaataTGGTGCAGGC
AGACGACGATAAGCTGACCCCGTCTCACATCCGCCTGCGCGATTTGCGGCAAAGTACGATGACAACTGTGCTGGTAGATGGCCAAAAGCTGGTGGAAGCA
TCTAAACTTGCAGTCTACGAAGGGAGAAGCATTGTAGCAGAACTCTTGTCAGAGCCGGAGACATCAGAGATCACCCACAGTATCGTTGAATTTGTGTATG
TGGACcgggcgtcgtggcgctTTGTCAAGAACATGCGACGCGAGGTGATAATGTCCGCCTCCGAGGAGAAAAATCACCCCGAGACATATCTAGCGGATGC
TGCTAGCGCTGCATTGTCGATCCCAGCCGATCGTTTGGCTTTCGCACGTATCCCATATCATCGCGACTCGATTGATATCCTCGAAGTGGTTTCTTATGAA
TTttcgcctgctgcagcatttgtGAACCAGGAGACTGAGTACCAGGAACTCTTCCTGGTGATCGACACAAGCGTGATACTAAAGCCCATGGGAAACGGAG
AGCGCCAGCTCACACAAGATTTCCTGACGAAGAAAAGCGAAGAAAAGACCCGCGCGCTGCGTGCAAAGTACTCGTCGGcttcgaacagcaacagcacgtA
TCAGTACCAGAAACCTAAAGAAGCCGCTCTTGTCATCCGCTCCCGGTCCAGAACTAGTGAGCACAAGGGTGctggcagcgtcggcagcagcaatggcaaa
aACTCGAATGGTGTAAGCATCCGCACGCCAACCCGTCGTTCCCAGAAGGCCGCGGCGCGTCACCATGCTTCCTCCGAtaccgacgacgaagatgacacTG
AATTCATGACGGAAAAGAACGATGCCCTTGACATGGACCTGTTTGGAGACGTGTCATAAGGCATGGTTGTTGTAGATTGTGTATCACCTGGTTGGCACAG
GAAGTGAATACCTGCGCGTACGAAACGAGTTTTTTCTAGAGCGGTAAAGCAAATACTACGTAGTACATGATTAAACCCGGCATCACGTTCATGTACTTCT
CAAGCCGGATTGGATTTCAACGCAATCTGCACAAGTATGATCTACAACTGCATGTAGAAGGCGCCATGTTATCACAGAACTAAGGCGACATCAAGTTTAT
GATGGCTGGGGTAGTCACTTCAGACACCACTACTGGCGTCGACGAATCCGTGACAAAAGCCTCAGTCACAGCCGTATCGCTCACACTATGTGTTGGCGCC
GACGGATCCAGGGAGCAACTTGCTAAAGCATGCGTGCCTTCAGATTCGGGAGGACTGATAACTGAGAAATACTAgtatcaccaccagcacctggCGTGTC
ACTATTCTCTTTATTCCGGCATCCGCTTGAGCACGAACAAGCAGGACTACAAACACGGCTCTGAGACTTGCATGCACATGCCTTCGTTGCGCATTTGCCA
TAACAGGAGCAACGGGAGGCTACACTGGTCTCCAGAAGCTCATCAATTTCGTCCATTACGTCCACGTCATCCTCATTTTTTGACAACAGCACCTTGTTCC
CTCTCTTCCGCTTTGTACCTCCTTTCTCTTCCACGTAGTCCGGGTCAGCGACAAAattgtcctcttcttcgtcactgctgctgaataACATCTCTATCGT
TTCATACGACTCGCGTGTCTTCCGTTTCTTagctgccttcttcttcgtagtTTGCTCGCGAAGATCCTGCAACTCCTTCATCACTGCCTCTagcttcatc
tgcagccATTGATCCTTTGTGCTAAGGAGGTTTTGTTCACTCACGACCTTCTCCTTTGTAGCGTCCTTCTCAACCCGGAAGTTTGACAGGGTCCTGTATT
CCTCCTTGCTTTCCAACAGCGCTTCAATAACGTACTGGATTAGATCGTGACAAGTATCTAGCCTTGGAGGAAAAAGCCCAGGTGGTAGTGCCACACTCTT
GTCAAAGCCCGGCAACTTCGCTAACTTCTGTTGAAGCGATCGGATGTTAACAGTCATTTTGCGGAGGTCATTCTGCAACGATGCCAGCTTCTCGGCATTT
TCTGCTGATTGCAAAGCCTCCAACCGCGAAATTTTACACGCCAAAGCCGTCCTGTCAGCAACCTTCGCCCGCACTGCCTCCTTAGTTCGATAAATTACTT
CTTGGGATGCcatcacctgctgcagcaatgctgTCATTGCCCACATAGGTTGGCCATCGTTATCACTGAAGCCACCACCAGGTGAAGAGAGAACTCTTCT
CGCAAACAAACGTTTTCGTCCAATGTCACTAGTGCTGGGTGACGGTGACGCCAACGTTCGAGCCCGCTTGTTTGTCACCGTAATATCCTCTGTCCTTCGC
TTTACAATTGCACCATCGTCCTTGGGTGCCAAAGACTTCCCCTTTTGAGCTTGATATTTTTTTAGTTGCTCCAACCGCGACATGTGACTACTCTTGTTTC
CTTCCACCCGTTTATCATCGGAAATCAATTCTGCTGTCAACGCTTTGGCGGGCGTTGGCGTTGTCAAGAGACTCGTGCGGGATGCCTCTTTGTTTTTCCC
TCGAAGTTCCTCTGCAATTTTTTTCCACTTGTCTTTTGTACTGTTCGATAAGAGAAGCTCTGCTTTCAGCTTGCGATTCTCCTTCTCTAAAATTTCAACG
CTTGATGGAGACCTCTTATTTCCATGACCCAACCACGAGTACCGATCTTCGCGTTGGAGAGATCCGTTCGCCAAAGCTTGGGTCTGTTCTAGtagttgca
gctgcacgatTTCTAGCTGTTGTTTCAGATACGCCACTTCGTTTTCGGCGCTGCGCTCCTTGTTAATCACTGCCTGGTTCTCAATATTTCGTGCACGAGA
AGCATAGCGCAGCGTGCTGGACGTTTCTTCGTAGTTGATATCGGCGGGGCTGATGCACGCAATCATCAAGGTCTTGCTGTTTCCGCCAAGACTGTCCTGA
AGTAAACGCGTCAACTTGGAATCACGATAGGGTATATGTGCGGTCCGGCTGCGTTCACACAGCGCATTGATGACGTTTCCGAGAGCGAGGAGTCCACGAT
TGATATTGACACCTTCCTTGAACCGTTCTCCTTCGGAGTTCGTGCGCTGGACGCGTTCTGATCCGGCCAAATCCACCAGGTGAAACTTAGAAAATCGTGT
TTCTgtgcctccttcagcagcactggcCTCGTAATAATCCATGGCAATAGTGCAGATGGCATGTGAACGACTCGATTGAGCATTCATGTTAGTCGAAGCT
GTAGCACGGACCAACGCTCCAGAGCGCAGCAAATCTCTAGCTTGGTCGGTTGAATTCACAACGTGTTCGCTTAGGCCAGCGACAATAATtccacgatctc
catcgccacgtACAGAAAGACCTGCGGTGGATCGCAAAGGCGTGTCGGTTGACGATTTTGCAAGCAGGTCGCGGACTTCTTCATTCAGGATCTGTAACAG
CAAAAATCAGTATGTCGTCACACCACATCAAAATTAACCACGACATTACCAACGCACCTCCAAGTACGACAACTTGATCACAAAATGCTGTGGATTTGCC
GAGTGGCTAACTCGCTTGAAGACCTGGAAGCACAATAATCGTTGTAAGCAGCCTACCACGCCCAGACAATAAAGAAACAACACGGACACTTTCTATCACA
CGTGGAATGACGCCGCGCTCGGTTGGAACAACACTCGACGTAAACTCGTTGCCCATGGTGAATCTGTGCACAAATCCACACAAAACTCAACTTACATCCG
ACAAATATAATAAAAATTGCAAAATAAAATACCCACGTCTTGCCAGATCCTGTCTGTCCATAGGCAAACACCGTTGCATTGTAGCCATCGAAGAATTGAT
CGACCATTGGCGCCACCAACGTCGAGTACACGCTCTCCTGCAGTAAACACAACGAAACAGCCAGCACTGCATTAATACACGATTATTACACTATTTAATA
GACTAAATCCATCCTTCTAACCTGCTGTGATGTTGCTGGAAATGCTGCATCGAAATCGAATTGCTTGTCGGCCAATAAAACGCTGGcatccaccacgtcc
acacACGTTTCTGAGCCCTGCGAGGCCTCGACGGAGCTCAGCGGCCGCTCGCgcactgccaccaccactgcatCGGTCTTGGCCGTTATTATACCAGCAG
AAGAGGGCTTCGACGCAACATCCAAGCCTATACGCCGCTTGGACTTGGTCGCCATTGACACACGCGCCGAATTTGAACTTTGCCCGGTAACGTATCTATT
TGTTTCGACGCCTTGGATTGGCTGGAATAAATAGCGTACTTTCAGCCAATAAGAACGGCGAGATCCAAAAGTTCTGGCTCGATCCCTAGCCTCGACGCGA
CCGTAAAAAAGACTTGGGCGAGAAAAACCGCACACAGATCAATCGGCAGCGCAGGAGGTCGGCGGCGCTGAGCGGTCGAGGGGGAGGCGTGTGAGGGCGT
CTACAGATTCGATCCGGCCAGCATGATGGAGCCAGAGCACACAGAGAACATCacggaggagaagccgcTGGTAGAGTAGTCGCTGAACGTCGTGTGGAGC
TCTCCATGTTGAAGATAAAAAACTGTGGTTTTCtgattttatttttttttatttattaATTAGTTGTCGGAAGACGCCGTGGGCATCACGATCAATGACG
ACAACAATGGCAAAATTGTACTCAAGGTCAAGACGCTCAGTGAGAAGCCGCTGCGTGTGGAGATTGCGCCGTCAGCGACTGTGGGAGAGCTCAAGGAGGT
CGTGAAGAGGAAAGCCAATGCCGAGGGAAAGTTCCTGCGTCTCATCCACCAGGGGAAGATGCTGTCGGACGATAATGTGACGCTGGAGAGCTGCAGGGTC
GCGAGCGAGGACTTTATCCACTGCGCTATCAGTTCGGCGCCTCCCAAGACGGTGGTCAACCAGGTGCGAGAATGGTttgacggtggtggagatgtgTAAA
AGTGGAGTTTAAATGGCTGACGATATGTGCTTTCAGATGGCAGCAGCTACAGAGAGTGAGCCGGAGGAAAGAGATGACCCATCCACAAGGAGAGGCTTCG
ACAGACTCCGTGACCGACTAAGTAGGGAGGAGATCCAGGCCCTGCGGTTGCACTTCTACCCGCAACTCTCGGTATATATCAGCCAGGCGGACCGCGTCCC
TGGCGAGAGCAGTGAGGACCGGATATATCGCCTGGAGGAAGAGTGGATGGCGTCACAAGGACCGCAGTCGGAGTTCGGTACGTGGTTGTCCGGTGCTGGC
TGGGTTTTATTGTGGTCGTGACTGACGAAGTAGGATTTCTATTGCAATCTGTAGCACTCAACGTTGTGCCGACAGCGCGTATTGCGATGGATACTCAGAT
CGACATGAATGGCATGAACAACTCCATTTTGGCAGCAGATAACGAAGGCACTGGCACTGAATTTCTGTGGGGGTTCTTGATGGGCCTCCTGCTTGGTGTA
TTTatgctgctgatggtgagTGTCTCTATTGCTTGTGATCGACATCTTGTCGCTCATTGCTAACGTGCTTGCCTGTCCGTGTTTGAttccagcttctcga
tcGCTCCGTACCCCGCAAGCAAAAGGTCggcctgctgctcggcgtGAGCATGAACTTCTTTCTGAGTGTTGTGCCGCGAGCTGTCTCTGACCAATagagc
gccgccgccagcgtgCACGACTGCCCCTttccgagctgctggcctGCATTGTTATATTATTCGCCCGCGAGTCTCTTCAACATGTTGACCCTTAACTCCT
GCGACCATTGAAAATCGTGTACCCTTCCACCATGTGTTCGTTTTCCACCAATGAAATCTTTTCGCCGCCGATTTTCAACACAAAAACGAGTAGTTCCGGA
ACCAGTGCTTCGTTCTGTCATGGTGTCAGTTGGTAAAGAGGAGCAGTCCCTAGAAAGCAGTAGGAAACGTAAACGCAACTCCACGGGATCGACCATGGGC
AAGGAACTCACAGCAGACCAGAAGGCGGTTGCCAAGATGTACGTGACGCGCGGCGCTGCCGAGGGTGTCGTCAAGTGCAGCTACtgcgagaaggagatca
cGTCCCGTAACGTGGACCGCTGGGCGTCGCACCTGCGTGGCTGCGTCAAGACCCCGGAAGACGTTAAGGCGCAGATTCAGCCGTTCAGAGGCAATGCAGT
GTCGCCCCCACCGCCCACCAGCGGCAGTTCGGCACCCAGTCGCGATGCGCAGCAGACGGACAAGAACGAGACGCCGTCTATTGCTGTCAGTGCTGCAGTT
CCGACTGCGATGCCTGTGGTGGCTCCTGCCACGCATCTACCCACGCCCAACCCCATGGGTACGGGCTACAACGAGGTGTTTAAGGTGCACGTGTCCAAGG
ATTACATGAAGTTCAATGCTGCTCACTTCATTGCGTACAAGGTAGGTGTTTGGTggtgaggaggaggaggtgtGAGTACTTATTGAGTTTTGGGTGGTGT
GCAGGGGTTCCGGGAGAAGCTGCATGGACACAACTACCAATTGGCTGTCACGATCACTGGACAGGTTGGTCCGGATGGTTACGTGGTGGACTTTGGCGAT
ATTAAGAAGATCTCGCGGGTGATCTGCAAGGACCTGAACGAGTCTTTCCTTGTGCCGATGAACAGTGACGCTCTGAAGGTACAGACGTGCAAAGTATGCA
GGGTGCTGGTGGTTGCATTAGATGCTGACTTGGTTGGGATTTTTTGCGCAGATTTCGTTTGACGGCACGAATGTACACATTCTCACGGAAGACATGGCGA
AGTTCAGGTGTGTGATATTGCGCGTTGCATGCATGAAAAACTGTCGTAAGAATGCTAACGTTGTAAAATTGCTTCGTGTTGTACAGCTTCCCCAAGGCGG
ActgcacgctgctgccgatCGTGCACTCGTCGGCGGAGGAGCTAGCCATTTACATCGTACGTATCTCGTTGGATGTGTTCGACAAGATGATTCTAACGTA
TGTGACTTGCGTGTGTATTCGCCCACCAGAGCAACCAGCTCATCGAGGCGTTCACGCTCGTTGCGCTCGTGGTAAGCAACGAGTGCCATGTATTAGTGCC
GTTATGCCGAATTTAACTggtgcgttgctgttgattgCAGGAACGTGGTGCGCGGAAGCTTGAGGTGAGCATCTCGGAGGCCAACCAACAGTTCGCCTCG
TACGAGCGCTCCATCCTCGCTTAGACCATGTCACAAAGCATCCCAACCCAACCGTAACGACGTCAGAGCGAGGCAAAGACCCCGTTCCACCGTTTTCTGC
GTTGGTCCTTCAGCGCACAATACAACGGGCTCATGCCATTTTGACTTCAACTGCCTGAGTCTCGAGCCATGAAAGGATCGCCCTTGATTTCGTCCAATCG
CTGGGTCTGCGTCATCTGATTGCTTGAAATCCCTCCTTCCCAGCAGCCAACCAAAACTCGTCTGGCCGTTCCCTCTCTAAAGCGATCGCTCCTCTGCCTG
CAAGACATCCTCCCATTCGCCAAAACGACTGGTATCGCACaagtgaccatcactctttGATCAGAACATgtacggcggcggcggtgaccGATACGGCGAC
TCTTCCTCGCGTCGCGACTacggcggaggcggcggcggctacGGAGGCGGCGGATATGGAGGTTCccgtggcggcggtggcggtggctaCGGCGGgggcg
gtggcggtggttACAGCGGAGGAGGGGGAtacagcggcggcggtggaggctacggaggcggcggtggatACGGAGGCGGCCGTGGAGGAAGCGGAGGCGG
CTTCgggggcggcggcggcgaccTCGGCTCCAACCTGGACACGCACATCCAGTGGGACCTGTCGAAGCTGCCTGTGTTCGAGAAGAATTTCTACTACGAA
CATCCGGACGTGACGAAGCGCTCGGAGGAGCAGTACGAGAACTGGAAGCGCGACAACCAGATCATCGTGGCCGGCAAGGGCGTGCCCAAGTGCGTGCTTT
CGTTCGAGGAGGCGTCGTTCCCCGAgtacgtgctggaggaggtggtgcgtCTGGGCTTCGACAAACCGACGCCGATTCAGTGCCAAGGCTGGCCGATGGC
TCTTTCCGGACGCGATATGGTCGGCATTTCGGCGACGGGTTCCGGCAAGACGCTTGCTTTCTTGCTGCCCGCGATCGTGCACATTAACGCACAGGTTCGT
ACTTTGCGGCAGACTCTTTTCAGAGGATTTTGTTCGTTGTTGGACGCAATTTCCACGGCGCTGGTGCGCTGATGGAGGTGATAGCAATGTTGTGTGGAGC
ACACGACGGTCGTTCATGATGAACGAGACACACACGCGAAAGGGCGTGAGGGGTTTGGATCGGTCTTCAGGGTGTGGTCGATTCAGTCGCCACTTTCAGT
CGATTCAGGTCGCAGTCTGCTGTGTTGGAGTGCCGGTCAAGGCGGTGGAAACAGGTTCCTCTCGTTCTGCGAAGGGAAGAGAGTATCCACCGACTGGCTC
CGACAGATTGGTCCGGCACGACCGACACACGTTCAGCTGGCTGATGCACGGCTGTCTTTTCTTCTCTCGCCGAAGTCCTCGTGGCAATCGATCGGTGCGA
AAACTGCATTGGTGGGTTGTTGGGCGATGGCCAGAACAAAAAGCAGCATGCGAACACCTCAAATCCCTCGGCGCTCGCTTGTGTTTGCTTTCTCGTGCAA
CGCTGCTTGCCTCGATGATGACAGTGTGCACTAACGTTTTACCTTGTTGTGTGCTATGTTTGATGTAGCCGTACCTGCAACCTGGAGACGGTCCGATTGT
GCTGATCATCGCCCCGACCCGTGAGCTGGCTGTGCAGATTCAGGCGGAATGCAACAAGTTCGGCGCGAGctccaagatcaagaacacGTGCGTGTACGGT
GGCGTCCCTAAGGGCGGCCAGATCGCTGACCTCCGCCGCGGTGTGGAGATCTGCATTTGCACACCCGGCCGTATGATTGACATGCTGAGCATGGGCAAGA
CGAACCTGCGTCGTGTGACGTACCtggtgctggatgaggcTGATCGCATGCTAGATATGGGTTTCGAGCCGCAGCTGCGCAAGATCGTGAGCCAGATCCG
CCCCGACCGTCAGACGCTGATGTGGTCCGCGACGTGGCCCAAGGAGATTGTGTCGCTCGCGAACGACTTCCTGACGGACTTCATTCAGGTGACGGTTGGT
TCGTTGGACCTGAcggccaacaagaagatcaagcagATCGTGGAGGTCATGGACGACCACCAGAAGTACGCCGCGCTGCAGGACCACCTGCGCGACATTT
ACGAGGGTGGCCGTATCATTATTTTCTGCGAGACGAAGCGCGGTGCAGATGAACTTAGCCGCAACCTGCGCAACACTCGCTTCATGTGCAAGGCTATCCA
CGGCAACAAATCGCAGGAGGAGCGTGACTACGTGCTGCGTGAGTTCAAGGACGGCAGGACGCAGATCCTGGTCGCTACGGATGTGGCGTCCCGTGGTCTG
GATATCAAGGATATTCGTTACGTGGTGAACTTCGATATGCCCAAGAACATCGAGGACTACATTCACCGTATCGGTCGTACGGCTCGTGCTGGCAACAAGG
GTACGTCTATTTCCTTCTTCACGGCTGCCAACAACAGCCGACTGGCTGGACCCCTGGTGAAGATcatggaggaggctgagcAGGAGGTTCCCCGTGAACT
GCGCGACCTTGTAggccgcggcggcggcggtggtggccgtggccgtggtggctacggcggcggcggccgcgGCCGTTGGTAAACGTTCCATGCGTGGCGT
ATTCAACCACTAGTGGTGACTATtaggaagaggaggagcgtTTGCAGACCGCGTGGATTGGCGAGGACATAGCGCCGCCCGCTCCATCTAAGAACTTGCA
ATAAAGTCATCGTCATGTCTTGCTGGATGCAGTGTACTTTTGCTTATCTTACATGTTACCTGTCCTGCTACACCATGGCAGCCCCATGCGAAGATCTCAC
AGAGAGCACAGGTGTGGTGCTGACCCGTTCGTCTCGGTCCTCTGGAATAAGTCGATCGAAGCGTTCGTAGTCTACGATCACTCGGTCTCGCTCAATGACT
GCAAAGTCATCAAAGCGCATGTCGTACGCAAAGTCATCCCAGAAGTACATTTTGCGCGCATACACATTCTCCGAGAAGGTCGTATCGAGCCCCGTGAGCA
ACGCGATGACTGCGACGCGCGACTGAGAGAGGTCTTCCATCGAGTGAAACTTGTAGAATGGCGAGTTCTCGTTGATAACGTGGATGAGAGTTGCTGGTAG
CTTGATAGACGGCCATTCTGCTGTCACGAGAGGCACATCATACATCTGACGGAGTCCAGTGCGTCGGTTTGTGAGGATCACACCAATACGAAAGAAGTTC
TCGTGCACTTCACCTGAGTGCCGAGTATTAGCGGCTCGAAAGACAAGGCAACGGTGTCCGTAGATTGTCGCGATGGTCATCTGAGACGAGAAGTGGATGT
GGGCTCGAGGTCGAGCAAACTTGGACCAAGCGATACCAGTAATGATCGTCACAGTAATAATCCCCACCATTGATTCGATAAATACGACAACGTTAATGTA
GACCGAGTTGGACATCGGCGCGATCGATCCGTATCCGATGGTAGCAAGTGTGTGGACACTCATGTAGAACGCCAGCTCGTATTTCGAGACGGTGACATCA
CTGTATACCGAGATGCTGCTTCCATCGAGCCAATACAGCAGTccaaagaagaagttgaTAACCAGGAAGGATAGCACAAACACGACAATGATTTTTGGCC
ACCGCACGTGAAGCGCACTTTGGTAAAACCGCATGAAGCTAAACGACTTGGGGATGTGGACGGGCAAAATACGCAAGAAGCGCGGCGTATCCTCCACTTC
AATTGACACAGCCGACAGTGTTGTATGAGCACGCTGAAGTCGCTTATTAGGGCTATTTTCCATGTCGTCctctccgtcttcatcaacagcatCACCAAAA
TCGTCGATGTCATTAATATCGACGATTTCGTCTTTGTGGTCTTCCTCGTGAGAAATTGTGCTTGTGTCGTCCTCAGCCATCGCAGAACCCGCCATTTCTC
TTTGAAGCAAGTTCTTCGCTCGAAGGCCATTGGGGCCCTCAAAAGAACCTCGCCCGCCTTCGCTTGTTAGCGCATCCCCACTGCCAAGACGGGTACGAAC
ATTGGAGTTGTCACTTGTTGTCGCCTGTGGCCCGCTATACGTTTCTCGAGTATCCTCCCGACTAGCCTGATCATTTTCTTTCCACACCCGCAATCCTCCC
CTCTGAGCAGCCCGAGTTTCGGCAGATGGAGCTTTAGGTATTCGTTGCGTTCCAAACGGCTGTTGTAGCAACGGCTCGAAGAGTGGCTCGAGTCCCATCG
CAAATTTCTTCGGTCCAAGTTTCTTCGAGAACGAAACAGGAGGGTGAGGCTGAGCCGGCATATCAATATCCGTAGTAATTGACTGTCCGTCCCAAGACCC
TGATCTCGATCTCGAGCTCAGCATAATATGCTCTGAGTACTCCGACGGAACTTCATGAACAGCCTCGTCGTGATAAGGATAATCTTCCTCTAGGTGGTGA
GATACTCTTGATTTCCGATGCGCGACGTTGTGTGTATACCCACTACCTTCGCTCTCTTGGCTGCAGGGTATTTCTTTAGAGAAAATGGGTTTGAGATATC
GGGCATCGTCGATTGGAGCGGACTCCACCGCGCTTAGTTTCGCGAAATTCATGATGACTTCAGCATTGCGCTCGTTAAAC