Description :
From Genome Similarity Track
Location :
Scaffold_1097:1365- 3682
Transcript NameFunction/comments
Phyta_totarag12030hypothetical protein PHYSODRAFT_323073

Sequence
2317 bases(100 bases per row)
TCCGTACTCCTAATTTACAGCAAAGTGGTTGGCCGCCCCGCTGCGAAGGAGATGTGCGACAAACGACGTGCCAGCGCTGGCTCAGTCCGACATtggtatt
gctgctgctgatgcgACGGGTGCCACGAAAGCTGATAACGATATCGTGCCTGTGTTGGAAGTGCACGTGCGGTGCACTAGTGTCGACGCCAGAGTAGTAA
CCTATGATAGAGCATAAGGAAGGTTCTAGAAAGTCTAGTCAGCTCAGTAGGAACCCCAGGATAGCCAGAGGCAGCAAGTTCTCACTTCTAGATTGGTAAA
TCCACTGAGGAGGCCTCGGTGGGGGCCGAAACGTGTCTGGCACGCGCTCAATCAAGTAGTCGTTGCATGTACTTAACTCCACATTTCTACAGCCTGTTTC
GTCAGGACAGAGTGTGGTCATCCGCGCAAGGTGCGAGATCTTCTGTGCATGAGGATCTACGCGATATCGCAACGGTTCCGAGACTTCCCTACAGTTGCGA
ACGACGGGACAAATAGTACCGGTATAGACCAATAGGAAACCCGTATATTGGATTTAGGGTTCTTTAGTGATTGGGATGCATGACCCCCTTCAGGCTTCAC
GCAGTGCTCATAGCCGCGAGGAAATGGCAGCTAGAGGCCTGTTGGCCAAGAAAATCGACTTTTCGATTCATATGCATAATGGGCTCGGAGAAATATGCAC
CCGAGCCCGCAAATTCATTAGGGCCTGAGAGGGGATCTACTGATAAGGGCGGTCTATTGACAGCGATGGACAGTTGTGGCAGGTTATTGGATGATTTATT
GACCAATACGAAACAAGTGAATGATTTGGGGCTTCTATTGGTAGATTTAATAGCCAATACGCATCTGCCACCTGTCTGCAAAAAGACACACGATGCGTTT
GTGGCTGCCAGGCGCTACAGAGGCTGAGCCGTTGCCGACCCACAGCCCAACGCTTTTACTCTTCAATTTTTCTAAGCTACTGCGCAGACCTCCGGTGTCA
AGCTTCGTACGGGCCTTTAcagacccccccccccgggGGGTACTGGTGCTGCGTCATGttgcgtgctgctgctgcgagcaTGCAGTATTTTGTTTGTATG
TTTACTGCTATGTCGAATGTAATATATGTATTTGAATTCACTACTGCGCGTCTGGCTTACACGTAGCCTACAACAGTGAGTATGTCTTGCGTGTCAACAG
GTGCAGGGTCGACGATCCTTCCGATGGCGAGGAGGCGCTTGTAGGCGACGATGCATTCGTCCAAGGCCCGGACTGGTGCAGCGgacgcagcgagcgcagg
ACGCTACCTGCTACCTTCGCGTTGACGCCCCGGGCTTCAGGAATGTCAGCACGCCGGCTTCTGCGCGGCGACCGGTGTTGAGGGCTTGATCCTTGTTGTC
CTCCGCGGTGGCGTCGAGGACGAATCCTCcatggaggaagagcttcgtgaaggcgacgacgtgaCGCGACTCAGATTTCTCTGGCGATCGACGGAGTCCC
AGACGCGCGGCACACGCGTGTACCATTCGTACCGCGCTGCTGAAAGGTTTGTAGCTGGCTACTTCCTGCGCTTGGGTTTTGTTTCTTGATTTGACGTGTC
TTGTACTTGTCCCGCTTCAGGGTTTGCTTGTATCTCTGCAGGCTTCAATAGGGCAGCCTCGACGATTGTCAGGTGGGCAGCCAGCGCGCGGTTCATCGCG
ATAAGCTCTTCAATGATAGCGTATTGGTGACAACTCTGGCATTCCTTGCTCTCGTCTTGTTTTGGCTTGCGTTGTTTGTCAGGCGATATGTCGAGGTGTT
CAGCGCTGCAGAACATGCCACCATGTCGGTACGAGcgacttctgcagcgtccaAACACTCTTCGACGCGCGTCACGATCCGGGTACAAGGCGACAGCGCT
TTCAGCTGCGGAAGTACTTGATCAGGTAAGGGGTGATTACTGCGAGGACTTTGCGACTGACGTTGAACCAGTGTTCCTTTAGCCCCGTGCATGAGCTGTA
CAgtagctgctggaggcgagCGAGTTGCTCCTGCGTCGCATGGTCAAGGTCGGGCACGTCCGTCACCACAGGCTCGTCATCAACGTCCCAGCCGCTCAGC
ACGCGCGCTACTTTGCGGTCTTCTTGCGGCGTGTTGAACACGTATACAAATGCCTTATTAACCTTGCTCAATATCCCAGGCACCCATGTCGAAGATCCAC
TgcatcgccagcttctcgtcccCGTTCGCATGCTGAGCGCCTCCTCGTCGAAAGGAGCGCGACGTCAAGTCTCCGGTCGTGCCCGCTGGATCCTCTACGC
GCTTCAGGAAGTGGTTC