Description :
From Genome Similarity Track
Location :
Scaffold_3987:1365- 2437
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3987-fgenesh-gene-0.0Splicing factor, arginine/serine-rich 12

Sequence
1072 bases(100 bases per row)
GGTCAAGCATGGCGCGAGATCGTACGTGACGACAGACTGCGTGCGCGCTTGCGGCTCGTGAGCACGTGTGTGCAGCGTATGCTGGTGTTAAACACACACT
GCTGCAAGTCTGCTACCTGCTCATACTGTTTTTGTTCATGTCTTGTACGATGCCACAGGCGAGAGCAAGAGCGCGTCGTCGCGCCACCACAAGTCGCACA
AGAAGAGCAAGAAGCACAAGAAGAGCAGCAATAGCAATGGCAGCGGCGACCTGCCGCGCGACGTGGACGCAATCTCCGAAGACGACTACTTCCTGCGCGC
CACCGAGTTCCGCGTCTGGCTCGCCAAGACAAAGTGCGTCTCTCTATGTGCTGTTATATTACTACGAGCTCATGATTCATTGACTGGCTGTTGCTTTTAT
TATGGTTAGAGACAAGTACGTGGAGGACCTGTCGACCGACGAGGCCACGTCTCTCTTCTGCGGCAAGTTTGTGAAGAAATGGAATCGCGGCGAGCTCGAT
GCCATGTACTACAGGGGCATCCCGGAGCACGTGCTGGAGCAGACGAAGCGTACCAAACACACTTGGGGCTTCGTCCAGCGGCTTGACGAGAAGGAGGTCT
TCGCACTGGCCACGGCGAGGGATTCGGTCGGCGTCGCCACGCGCAAGAGCGACCTGCTCGTCTCAACCGCAGCTAGCGCTCGGTCTGGGGCTCCAGAGGC
CAAGCCTGTCGTTGTTAGTGCCCCCAGACATCAGGACGAGGACGAGGACCGAGTTCGACACAAGCGCAAGAGCCACCACCGAGAGAGGGACTCGGAGAGC
GACGAGGACAATGACCGCCAGCGCCACCGATCGGCCCACAAGTCGGAGCGCAAGAGGCACCGCAAGCACCACGAGGGTGTTCTCGAAGAGCTCGCGCCCA
AGGAGACGGGTCGCGAGGCGCTGCTCGAGAAGCGCCGCCAGGTCGGCAGCAAGCTCCATGGCGCAGCGCGCGACCGGGAGGAGAACCGCGACGGACTGGA
CCTGAGCGAAGACTTCCTCATGGGCGGCAGCGGTGCAGGCAACGATCTGCAGCGGCGTCTCAAGCAGCGCGA