Description :
From Genome Similarity Track
Location :
Scaffold_27:136464- 165034
Transcript NameFunction/comments
Phyca_LT1534115100transmembrane protein, putative
Phyca_LT1534114913necrosis inducing-like protein NPP1 type
Phyca_LT1534547933Ran guanine nucleotide release factor
Phyca_LT1534115063Holliday junction ATP-dependent DNA helicase ruvB
Phyca_LT153417346dynein heavy chain
Phyca_LT1534115097dynein heavy chain putative
Phyca_LT1534528133lipin-like protein
Phyca_LT1534115114helicase
Phyca_LT15348284malate synthase

Sequence
28570 bases(100 bases per row)
ctttatcgtgagttcctttatcattgtggaacttgccaccgaaggccatgaaggcgccatgtacggcctactcacaacagtttacaacctcgccatcccg
ttcgctaccgctatcacccgtaacgtggacagtttgttcaacttaaccaacgagcggatccaaaatgacaccaactccgtgagaaccgacatgaccatga
cagtactcatcatgtggacagcaaatctatgctcgctcgcgttcttggtgatgctgccccgacagaaggagcaaacacgagccatgaagcaattaggcgg
atccagctacttcatgggcgtcgtcacggtcacgtatttgttgttcgctcttctgtggacaacttctacaagtcttttgagtatcttcgagagcacatcg
tgtcttgtcattgcaggcggcaatgggtgcgacaagggacctgtgaagccgtaaaccagttcgtcaaagccaagtgaagtaagtgtttataatgacaaaa
gaatgcagcaccatcgctgccaagtgaactctttcaatattagtagtactacagtagtacatgtaccacaccagtgacgatgccactgacaaccagcgtt
atcaaaatttgataatttaattcaggatcgatttctttggttatacttcgtaaaagtaatcaatgctacatgtacgcacgctatcgcacgctatcattga
tgtcttgccacactcccaccatcgaagattgctctcaaggaacagtaagacggcaatgaaatggctgggtagcccaaatctgccggccactttccaattt
ccctactcaagatctcttcgcagctttcacgatggcagcccgcttgcttgcggtcctcgcaaatctagtcatggtccaaggtctgcagaacggcttctac
attgacgttcccgaaggagccctcccttttgacaaggtcgaaccatttccggagttagaacccacgacaatttcgcaaaaagctgctgtcagactcaaac
cgcaactgcacatttcgaaaggatgccacccgtatgccgccgtgaatgctgccggagaaatcactgctggaattacgactacccgtgacccggattgcag
tggacgtggaattggttcacaagtttacgtgcgctcgacatggtataaagatgtgtgggccatcatgtacgcttggtatttcccgtccagcttgatccac
gactggaaaaacattgtggtctggatcgacaacccctctcttgcagtccccagagtcctaggcgtttcggcacaggtcgacgggggatatttgagataca
acaagttcaactgggataagtttgacggtgcaagtccgaaaatcaaatacgactatcccgacttggactggacttcaaaacgtggcgagttccaaaacct
cattatgtgggaccagctcaccgaagcagcacggacggcgctgaataacactaatttcaagggcaatggagacgccactgtgccattcattgatgccaac
ttcaaagcaaacctggactttgccattccgtacgcgtttgcttagattcgtaggaagaatgcaggagtttgaccaatccaacatttcatcttggacctgg
aaattggaaaatgattcgattgtgttgtttgtttcctcaccaaaagcaagctgtaaaccaattcgtaaagaaagtgtttatcatgccatcgctgccaagt
gatctctttcatcatcatctccaccactcagtcagcgttactaagctatctctcttgctccgttccaattactgaaacaacgaccagtccaggacggaga
acgactgcaccgcatgcgtaaatatggaggcggctacctccgagttgtcttcaaactggaaagcaccgtggctactgctagccggattgatgcgcatggg
cgcagacaccgacaacaccacgtctgtcgtcacaccgggcaatcggatgttgcccaggtaaacgcgcaccacgttcttcgcgtggtcgccctctttgaac
ttggccacgcgttgatcccccacaatcagttgcgtagagtgcggagcgtcaacgattgcaggcgcgtgtctttcgtctgccttctgctctagcagcactg
tcacctcgtcggggccacagccgttggactgcgcgatctcattgaagaagtagcgagcacttccgctgtccaacacgctctcttcgtactgtagcagctc
cacaattacgcactggtctgtctctgcattagcgaacacttcttggttgtcgggtacctgtcggaaggagctcacgtccgcgaagccctcggggatctcg
caactcaacgcaccaccaaacaatggacggatcatctttatgaatatggtggttaaatggtgggttaaagaattgagtacttaatggaaggagtgtaatt
aagaagtataaatatattttcactaagtttacatttttgtatactttccagcgaaattggatcgcgaccattagatcgaaaaaaacattaagtgaatatt
gcagcatgaagatcgaggaagtgcagtctactgccaaggcgcagcgcattgcggtacacacgcacgttaaaggcttaggtctggaggcggacggtacagc
gttgcccattggctcgggccttgtaggccaggagaaggcgcgtgaagccgctggactcgtggtggagcttatcaagtccaagaagatggccggccgcgcg
ttgctgttggctggagcccccggaactggcaaaaccgctcttgcactgggtatttcgcaagagctagggcctaaagtgccgttctgccctatggttgggt
cggaagtgtactcttctgaggttaaaaagactgaaattctgatggaaaacttccgtcgggccattggactgagaattaaggagagcaaggaggtttatga
aggagaagtgacggaaatgacgcccgaggagacagagaatcctcttggaggatacggcaagacgatctcccatgttattgtgggcctgaaaaccaccaaa
ggatccaagcagttgagacttgaccccagtatctacgaagccctgcagaaggagaaagtgtcggtgggtgacgtcatctacattgaggccaacaatggca
gcgtcaagcgcgttgggcgctcggatgcttacgcaacggagtacgatcttgaggctgaagagtacgttcctattcccaagggcgacgtgcacaagaagaa
agagcttattcaggacgtgacgttgcatgatctggacattgccaacgctcgaccgcaaggcggacaagacattatgtccatgatgggacagatgatgaag
cccaagaagacggagattacagagaagctccgcaccgagatcaacaaagtcgtcaaccgatacattgatcagggtgtggctgaattagtgcctggtgtgc
tttttgtggatgaggtgagcactctggacatttgctgctgctgattgaaatgctaataaccgtttcatcttatgctaacaggttcacatgctggacattg
agtgcttcacgtacctcaaccgtgcactggagtcaacactggctccgattgtggtctttgctactaaccgaggtgtgtgtcagatccgtggtactgacgt
ttcggcccctcacggtgtaccgctcgatctgctggaccgtatgcttatcattcgcacgatgccgtactccgtggaagaaatggtgcagatcattaagatc
cgcgccgaggctgaagggatcaagctcgtggatgatgctaccgtgcggctgggcgaaattggctctcagacttcgctacgatacagtgttcagctgctga
ctccgtcccggatccttgccgagactcaaggccgctccgaggtggcggtggacgacattgaggaaacgaacgacttgttcaatgatgccaagcgctcagc
ccatgcactcgcgcagaccgaaggataccttatgtaacgacagacaaagatacctgcctccccgccaaatacaccctgaacagtcggtcaccccactcga
tcgcttcccattgacctccttgtgttctttttgtgttggtagatgccatgagtgaagacattgtgcgtgagtcggcaatattcgagacactgtctccacg
cggatacgtgcgaccgggaagtactggagctccacttatttccctccccctggtgaaaccccgagatgcgagctcaatcctccggcaattgacgactcct
cagtcgctgatgatggcggttcccattactactaacgagtgctggctagtgtggaagttcttgtgcgactgggtcaagacgcaggtgggtttgcccaaat
tattaaacgttgacggttgttcacaacgttttctctgtagttggcaatggaagttcctgcgtcgattcctggtttcgggacattttacgtgcgagtgcag
cccctgggtatccgtattattctttttggtaagatgtttctccacttgagcatgtattttcaagcacttacaacaattcttcatggtgtagagcccgaga
agaagtttcttacgaaatattacatccaagtcgactctgagatagctgaccctgcacttgttgcaacactaccgtcatccatgacaagttccgagtcgtc
agctgctggtcgtaatagagctgctagcatcgtcgggcttggcgagatttttgcgtttagtttcgtggaaatggcttcctgttgcggacattcggttgac
tcaacgagggcacaagagctgcttaacgtggtgattcacaaactggggagtgcaatgggtcaaggtggcagagtaagttgggcgtgttcaggtcatattg
ttgcgctttcactgacaagcagccaattgttatcctcagatagagttgaatattggtgccggggtgattgtgtgtgttgatcgagttatccagcgctatc
ttcttccacgcgactcggtatcttatcgcaacgagctttttattcgcgactttttactaacattttttttgttttagcgcctaacaccgcgattcgagta
tgaagtgagaacaggagagagcattgtcaagcgaaatctacgtacacaagctgctcttcaaaaaatcaatgcgccaaaagccaagtaagttgaatttaca
acctggatttgtgctacatttctaactagcgtcgtgcgtagattatcttttctgtcgggttcgacatttgcttcatccatccagttaaaccccgtgctcg
atcgatcgaaagatgtacccgacttctcgtttggccctcgacccccagcctcttcatacatgccgatcggttcggacgccagaccatccccccgatcgac
gcaattacagaagcgataccatcgaacagcaagtcctcgtgcgagccgccttaatgcgccttcaaccccagtcgtcgaagacgacccagcgaatgagggc
agtttgtctatgaaggatacaaaccccattccggagctatttgatcccctcagtcgcaccctgtgcgtcgaacctgacctgaatgtgtccagtctagtcc
cttcgaaccgcattgggtctaatttcactgagacggcggcatatttgatggctgaaaaggctgcaagaggtttggtgtttgttgataagcctgccactgc
taaaacgatacggcaaaggaatggtggagctcatgagtcgacgtcagaacagcggtactttgagtatttatctgatgacaagctgatcgatcgacgttgt
ctggctcctttgccgactgacgtggagacgagagtagtggcagctgcagtgaaatacatcgcgggcccctcgactgttcatatcgagaaagtgatggagg
tggcacaccaggaattcgtggacaattactacgccagtgccaagaaagcgattctaaactatctgctcatgcgcgctgtaactcgcgagcggcttggaat
tcctttcggaatccccgtacatgctcttctgccgaccaaatggaagtggggcagtagtgacgggccgaatggttgtatcgcagactttaaagctttagtt
tcgaaaccctggggcggactgacacaaccgaagtatgcaaagatacctcaaaagcctggtgtttcttgctctgagagtaagatagagcggcgcaaacgtg
ttcagtcgaagctagcgtcgcttctcattctatcgaacccgcaggttcgtgctcttcgctacatgtggcacgatttactcttgtcggtctctcttgtgga
catccccagtacccagaatctcagtgaagctattgaaccaatggatatcatcgcttttgagcgtgctcagttggcattttcagccaaaatgaggactttc
atgatggaaaactggtaccacaaggtcaggatgatgttcgagagcgtgatccgagctgaaactttctccattcacacatcggaagccgctgttagctttc
ggttgcgccacctttttgacacggtagcagcagtcatgtcgttccagatacgttcgctgatcctcaagtctatcgaaacgtacgtgaacttcttcgaact
gttcggagactttaacgatgacaatcaagagagcagttcccaattgcaagtccaagagcgacccaagtattcgggcttgctaacaactctggttttgcac
gacggtcaaatccagttccgagaccctttggttgacattcccagtcgcctgctgaatgtccttcacaacatccccaagctcttctacaatcttggacgaa
tcgagacgcagtttgacgagccgattttcttgcctacaacttgttcaccttttctgtggaacgtagcggcacaagaagatgatgttgtggttgctacaat
ccggatccgagccattatcgagcgaaacctcgcgtatcttcgcaagttacagagagattatgacgttttcgccttgacgcatcggtacgtgaactctgtg
gactgcttccatctggaggaaaacggagaacttgaaagttatcgcgctgaaatggagagggtgcaggcaacagccatgcaacttgccatcgacaaccaac
attcgcagcatttaggccttttctcggtcgattgtcgggatgtgaactcgaaattgcacacggaactcggccaatggactatccgactgctccaagcttt
tgagcagcgaacgggacggatgaatgctgaattacggcagcagtacaaggaaattgcagctcgattggccaagaaaccgctggatttgtacgaactggtg
gatgctgaggcatttgtccaatatcttaaggcggaaaagctgcaagaacttcaggataaggccagcgtcatcaagcagcggcttcggttcttgctatttg
agcgggaaactatacacgttggttacatctcggttgatttattggaaacagggaaaaacgagaatggaaacggaccttcgctagctgcctttcgcctctc
gaccgatctcttatcgtcgactgcaaagactgtcaagtggagaagccacattgcacagttgctgaaggaagccgaggctctccttgtgaatgaacggact
cggatagaggccatgtttgtagctaaaaggtcccgattccaggcagaaatcgatgaatttgaaggagaagtgcgcgggtttgccaagaaaggagacctcc
gacatgctgccacatacgttgtccaactggccaaaatgcaagacaatctctttatctttcgccaggccatggggaccattatcaaggaagaggaaaagct
gatgtggaaggccactgactttagtaaactggacgatatcgccgaggaaatggccccgtacgagcaactgtggaagaccgtgagagagtttcgggagatg
aactctcgctggttgcgagggaatatcttcgagttaccaggtaaagaaggactgcagacgcttcagcagatgctttcagtggttgccaatgtagctagcg
ttctgcttctgaactccgccgcagctgcaatcacagcggagacagttcggaaacaaatgactgacttccgagagaatgtccggctgatcgtagcgattca
gaaccctgcgatgaaggagaggcacatgaaggcagtttcagctctgatcggactcgacttctgctcggacgaggtggtgacgctgttgaaattactggag
aacggagttttcgaactgatcagcaatatcgtcgacatcagtagtaacgcgacacaagaacaacaaattgagcgtgcactggacgaaatgaaagatgaat
gggacgcaaccagcttccaactcgtgccttcgaagcacccgttcacgtctggagctgtcctagctccgttcatggctatggatgacgtgggctcggatgt
gtggggtgtcgtactggacaaaacgtgtgctgaacatattatttctctcaaggaggaccatcttttaaggcttcaaacgttatcatgtatggtgcatgca
ggtccattccttgaggacatggcattgtggcaggcgttcgcctccaagacaggacaggtggtcgaaatattggtgcttattgaacaacagtggcggaaac
tcactccgctttttgcagcgggaatcgttgagaccgagtcgactgagtctaagctctttgcccacgcagcacagctctaccggtctactcatgctacaat
cttacgtcaacctgcttgcaaggcgtattttccatcgggtagcagcactgaagcattggtttctcctactgcatcactgaacgcagatttaaatcagtgc
cgcgagctactggagactgtgcgagctggtgttcgggtggggtttgacgccaagcgatcaagttttactcgcttttatttcctctcggactccgagcttg
ttactgcgttagccttggccaatttcccaggtgattcgacgctgtggaaagctctttctcgctgctttccaggcatcaacagcgctcaaactaattcttc
gcatgagatcacagcattgcttagttctgctggcgaaccgttcccactcggatccccgatcgtcacaacggatacgccaatgccggtgtggttggcaaaa
gtcgagacctccatggcaacgatccttcacgcttcaattcgagctgcttgcagtgatttgccccgtaaggaattccggaagtggtgcttgatctggcctg
agcaatcccttcttgctgcgattcaaatctcctggactctggagtcagagcaagcgtatcaaaatgaaaaccagcggaaagcctggacggagatcacgag
taatctctctgaaaacttggacgctgtcaggaaggagattcgagtggcagcctacccacatgtgaaagccacgctagggaacgtgatactgttattaacg
cagcttcgagacatcagtagccgagttcttgcggaaatttccacctcgtcgccgtacttgacctggatcgcccagccgcggttttacttcatcgacagcg
tcttgaacgtcacgatgttgacctcgtcatatctgctttatggacttgaatacctggggaacggcactcccggtatactggtaactcctctaacgttacg
gtgtttccacgctatcgcgcaagcagcaagcacaatggcaaaaggagcttgcttacaaggagaagctggaacagggaagtcgacgatctgctaccaactc
gctcggttgtgcggccggttgtacgtaacgttccagtgtggcagcacaaagctttgttttgatgatctggttagctttatcaaggccaccgctgcctctg
gggcctggttgtgcgtggataacttgcagctgctggatgcaacaaagatatcactgctagtgctgctgtgttctcaagtcatgactagcctcgcggctag
acacgcacagtgtgttcttgttggagacaagattcgtctgcgaaagggagctctgttcttgctgacacgaactactggacctgttccgatccttactgat
gcctcgtgtctgcaaaacacgagctacttctttcggccgatcgccgttcaatgcccagatattgagaaaatagcggagttcgaactccagtgtggcagat
ttgttcacgctgctgaattagcgaagctcgttgctgtgacactggctgcttttcaacgaggattccaactgttgcaaccggctgatggtgcaaaagttct
cggacctggaaaagagacctgcgccaagtaaagcaattattaggcgagcaatcgagctcaacaacctagagaaggatcaccgacgacgcaccaggaagag
tattctcataaccccagacgtagacgaaacggaggacgtctctactcctcccgtggacgcgacttcggaagcacttgtacaacgccaggaagaggaaatg
gagtaccgaaatgtgtgtctatcgcttcgagaacgtctcgcgtcactggtgccgccggctaatctccacttggttgacgctatcatacgagactttaatg
ctcatgcactggatagggatctccttagagcgacctgtgggaattctatgcggtcgacttctggattgagtgttatgccacgacgaacgcttgaagatga
agtggaaagttacgttcgcaacagtgagactttgtggaagctttttgaagtggagtttagcttaaaggttgttcaactgcttcagacgatgaggcattct
cgtgcggtagttgtttcaggggaggttcaagcaggaaagtccaggctgtgcacttgtctttctcaagctcttacgaatattagccgaaagaaagctgcaa
atcaaagcaatgtccctcgaaaagtggaaattggagctatggatagcgatacggcactcgcagtccctacacgctgtgtttttatctgccctagagcgct
tcgttgtggtcaattaatcgacttaaattctgatcggcagtctcaaagtgttttcgctaaacttttaaaagaagcgaaaacaattcataaagtggacaag
ggaacaaatacatggattgtcttcgatggcgacctggacgcttcttggagtgagcagattctgtatacagtagaagaccttcaggatgagattccggggc
acaaaaaaggattgcagttatcatcgggaaagttttttgctatcccaacattcgtgcgcgttgtcgtggagactacgacacttgcgaacgcttcgcctac
atttcttagtcgagttggcgcagttcacgtaaacggcgatcaaaatggtgagaagtgggaaaatgtgtatttcatctggaaaaatcagcgaagggctgag
tttgaaggatatgcagatagcattttcttagtactggatacacttgtggcggaaactgtccccgcgagtgtggaattcgtgacaactaacttccaaagct
ggtggggcgggaggcaggatgtggaacggatggggtggatgtttgctttgttttacagtgtgttaaaacactcatgggggaaattttgttcgctgacgag
tgagaaacagcgcagaacagctgtccattgcgtcttcttacaagctctagtttggggaataggaaacacctccattcctcttgaacgacagaagtttcac
ttgttcctgtacgatttgatccttcgaggacccaacagcgaacagtcaacgttgaagcgtttagtgacattatttttccctgctgggacgttagttgatt
ccaacaatgacaaacatactggtgtggcaactgggggatcgacattaggcaagcaaacaatgtatgacttcggcttttctgtggactttggatccaaatg
gttgccctggaccgaatactacacccgatggacgcagaagttttcgggttctggtagtttggcagcctcaaatgcctctggattgagtgtttcttccatt
atcgtccccactccaacaacgtcagctgcaattatcttgtctgggcagctcttactcgcgaactaccctacaatattatctggtcctagagactgtggta
aaactcgctgtagttctttgtggctcatgctgagtgaaaccttgtcgcgtataccagcagtgacccctttatcgactgattcgtcccaaccagaagaagc
tgatgcccaaacacaagtggagactccaagcagtgaagatcccacgggagcgaagaagatttacgctgggtactatactaatgctagtgacgttctgttt
catttcgagactatccttcagcacattcggagtagacgccaggaatcctccagacgtacagatgattctcatcctgctttacccggtggacgacacactg
tgtgcgtgtttgtggacgatgttcactgctttgattgtaacaggaaaatgaattctgctacggaattcctacgaatgctcgctgaacagcggacggtcgt
ggacccatcgacgaatgtattgacgccatgcccaaatgtccttccgtttgggacactgcaaacgccagtaccgaagactgagctaaaccaagcacgaaac
taccatctcgaacgctttgtgcgacgctgtgttcccgttcctctccagccgttttcagattcagacctcattagcatttgtgaaagttttccagctgcag
cctcagcaaccagtgagcaaaggtccgcaacatcttcatctgtcactgcagctgcagcagcgctgttaaaagaggccggacagcttcaatctacgctaat
caaggcgagcttgaaagtattccggctttgcaaggagtttacgaaagatgcaacgttcaagccgattaagctccactatgacttacgttcagttcagctt
ttccagcttgtggaatctatttgctgtgagatccgcccaacctggactcagtcggaaaaaccatctctagttcggttgtggtgccatgagatcgtgcgat
tatttggtgatatgatcgtggatgtcaaagaagccgacacgttttcccaccgcgttcttgagatcgcattgtcgagctttggggttgcagacgaggtttt
tttccccagcgcaactacaaaagaatgtggcacaaaacccgaaaagcgctcaaaactggctggcaaacgagttacacttttcgtttatgggcgagaacgt
tgggtcttatcgcaacgggtacgttgagataagcgaaatggccaaagttgaggctgtggttgaaagaaatatgagggcgatgtttcataccggaacgaat
aatggagagaacgttgagatcgttctgtgctcgcacgttatcaaactcatgttgcgggcgacccgactgctacgaatgaataacagagcggtactatttc
ttggcgcaaaagggaagaaactggttactatcacgcggttagcgtgctttatatgcaagaaaacaccgtccgtttaccgtatttcaggtactgtatccga
ggaggcccatcacaacagcaagtggtgctcggcatttcgagctgctctgttaaaaagcgttcgtacccgtgattcctccgtggttttcatcgtgaaagac
tgctatttggacccagattcacctatttatcgcattctggaccagtttctgggtgggtttaacaatctctctgaagtggtcacgtacgatgatctagacg
aagaaatcctttccattatccgagaaagacaagaacaaattcctctctcgtcagaaaccgtatcgacaagtattcgaaagccggttgtgcttcgctcgaa
gaattcgacaattgatcatttctttcagctcgtgcggcagaatatccagattgtattgatattttcgcctttgtcgagtcctgtggatgaattggataat
gtggtctgggcgccgattttatggcgatatcctaacattttaaaattctgcactgttaactatgctggtgcgacgccggagaattcgatgctcacaatgg
cgcaaaagtgtctggctcagtcctctttaactctggacaaacaggaattttcacaggtctcggaagctgctgtccacgtgtacaatacattttgtcggtt
ttcaagatctggtcaggaaaatggcgcaattgtgcctcaatttatgagtgtggacccagcaatgctcgttgagcacgtggctttgtttgcttctcacttt
gaccggcttgaacgttcaatttcatccaacatcgctcgttacgagataggattgggatttattgacgaaacagcaaagatcctcgaaatggagcagagcc
aagcggagttgctgctgccagaagttcagtacaagactgagctcaggcggaggatgtctggcaacgtagagagggtaaaaatgacagcagacaagttgac
tcgaggactggagttagctactactttggttaccaaccaacgggaaagacttgctgctgttacggaagaatatcaagacttaatcagcgattcacggcgt
gagtttgacgagatgaaagggatcctgcaaccatactacgaatcattcgactgcgagggtgtggatgatcacggggaagtcgcagatgatactaagattg
atgaagaacagagatacgaagagaatttggaggcgaagactacacatgaggaatatttcgaccgtgtgacggacattaacgagggaaatgaggctcgatg
gcgcctccgtgagcacattcgcgagttcacatcgctggaacgcatcccatcgtctattttacaactgtccgagtgtcttggtgtaatttttgggatagaa
cccgtagaaggacgtgatgaaatggaccctgacgaaattatcatgaattattggaaaaacgttgcgctgcagatagaaactgctgaattttgggagaaat
tgatagcctttgacgtccctaagaatgcaactgaaaagatggttagcactttgcttccgatatgcagatcgccggattttgataaggatttattcgcgtc
tgtacatgagatcgcgggtgttttgagtgagtgggtgatcaaatgtatcacctttgcccgggattttattctagctggacccaagtatgatcaactccat
cgagaacaagagcagctcaaacttgcggaagcccaagtagtcaaaagcaaaatagatatctacgaccaaaacgcgtcctccagacagacctacgaactac
acgatgtgtcggaaatggagagacaacgagcggatgaacgactacaagacacgacctcactgctgcatctgacgagcgccgcgtggaaagtattatcttc
tacgcgcgagaaatggcaacgtaattggatttctatacagagttcgcaactcattggaaaggagatttgctacttgccacagctacaatagtgtacgctt
cgtgcttgactcgaccattacgtctacgtttgttccagcaatggatagaaacggttggagtgagctcgtcgccttcacggcgatatatgcacgacgtttt
tctagttcaagaggtggatattagcaggatgaaagctacggggctaccggctaatgatgaaagcgcgctggagaacgccgtgattgcactaaactgcttc
tgtccacccctactcatcgacccttatggagtcgctacagattggttgaagtcacacctgatctcccagaaacttgctgtcgtatctgctagctatacgt
caactagtagtgaggtttggagagcggtggagacgagtatcaaactggagacgccgttgatactgacggatatatgcaaagaacgcttggagagtctgca
ttcatttgttagctcgaagcgacgatcattattcgatgcagtaaacctcgaccgtaatcgtacaagtgacggctaccggtgctggtgccttcccgctgaa
gaaaccacagtagaacagtctactctcgagttttacagcgacgcgtgcagggttttctttacctacacagactctgatgttcttccagaatggctgtcgg
agtatttgagccagttgacagtgattcagttcgaaatgacagcaccttttgtcgaacagcaagcgctgaaaaggcttttagaggcccaagggcggcttcg
tgagctgactgaaatccgcacactggagaacgagatgattatatgtgacgaacagactttggggctcgaagaagaactccttgatttctttagcacggaa
aaggccgagaacgtgtatgcagacaattccaaagctcttcgaattgtcgcgaatcggagtgcggcgcagactcttgaaagtacaaaagcagaagcgaaag
ataaagttcattcccattggagcagcctggtcagttatactgctgttgctaaaagatgcctggatgctgtgtgggcatggcgagaattcaacgttgtcct
tagcatcactgacacttttgcagagaaaacgtttccgctctctcgggtctggcgtttgttagctcgcgctggtgaaacatgcagcaaagctgatggaaat
ctcgaggtggtaatggcttgctttacaaattatctccagcagagcgtggagatgaatcttcgtgacgaagatcgcctactctttcgcttcttactagcat
tgaatattggcagcggcgtatgaaagaagaggaagcactggtgaaacctggagaggtggacagtcgtcaagtgagtgatattgagatgctcgggcgtcta
gttgcacttattagctgcaagacggtccgaagtgactatgatgtgtgtaaacccacgttaaagagtttattagcactgagatccaagggtatgaaatcta
cggattggtcggctatctgctatctggctgagacgtctgagaatttgcggcagtttatatcaaggatggagagtttggaagacgggaaaacggtttggaa
ggacctccttaatctaggaacacacagctcagcggattgggaggtgccaggtccattggatgcattcactcgaatgtgcatcgtctctgcgatttatccg
caccgattgatgagtgagatcgaaatctttgcaggacaagagttacagcggattcacactgttcctgccctcccacattccaacgtattagtggcggaat
ccaacacacctacactccccactgttgttgcaacgctagctcatactgcgatggcccaaaagcctgatagacaccgtgatttattctacatgtggcaatt
attctccagttcaacaacccctttggttgtgttttgcccgcctactatcgatttcatggatgctgtcaccaacgtagcacgtcgtgcaggagcaaccatg
gacacttcagatacagtccaattactgttagctgaggaaggcgatttcaaaattctactgttacaagctatggaaaaggggcgttgggtagtactgccaa
atctccaaacgtcccaggagcgattcgtgctgctgagtcgtatttatgaaagtctagaggatggtcgcactcattccgacttccgtttatggatatcgat
aactcatatcgattcaaattcccaagtcatgcaccaagttgattttgactcgctacggatgagcaaatttacaattcatcggaaatgggccggtgggtat
ttctcactgaagcgaagtttacatcacacgtttgctattctgaagcgtgaggtcgaggaattgatatttgcaacgactacaactcaacccaacgctgtat
tgagtgggagccaggaaaagtgtttgaagcagcttggtgttttccatgccctaatttcctctcgagaccatttttcgtttggtgggtggaaatcggaagg
ggaatttggagacgccgagttatgcgctgtaattcgctctttggcgacgttacggctggaaaaatctactgaggttccaggcctagtgggggtatggaca
gaaatgactttacgtggcattatttcgtgtgtttacgtgccaaggttaagacctcaggaccaattgcttcttgagtcttacttgaacctcgttctaagtg
cgtggccgaccggggatgatggtgtagagccccattcaactgcgactgcagcccagatggccctcccagaagctgttttttcgatcgaaaagctggcaac
tattccgtgggggtcaataattaacgctattccaaatttctggacaagtgaatcgtgcggccctccaattaggacagaggttttggcaggacaaacgtta
caaaccgagggagcagtgcaatgggattcgcagaatatccgcaaggctcgccaaaacaacctcgcaaatcaactggctgtgctggctgtgcatcgaggat
gtcatattccagctcaatatctgtcttctcggttctcttcaaacatggaagtgttatcaatgctggagcatctggcagagttcagggagaacttggacgg
gattgttttaccaacgccgagtagtgattttgactattgtaagcctcttgcagctcttgtgaaccgagaacggaaaatgcttgaagagattcgagctgcg
gttttgcgggatattgagcaacttgaattggtgagttgctgaaaaataaccctccaaggtcacttcgaagctaatttaacttactttcttctgtacaggt
gagcaatcgctgtgtaccgctagactcggcttgctggcaactatccatcgagttacgagggaattgtactcctaaacgttggatcaaacttctgcaactt
ccagaacagtgtggcaagtctacgggagggattagtctggaaacgttccaatctattcttctagatcgacttaacacttttgcgtcctggacagaactcg
aagatgaaccgtacaggctccaactggacaagtttttgaatattgaggtgcgtacatggttcgtcatcttcatctacacacgatagtcttaaatttgcat
tttgttgtgttgaagtgtgtgtttgaagcagtgcatcagaatttcctccgaaagcgcacaggaaacgctttatgttcttctgattgtctgaaggtggtct
caatatgggaggatttgccacagctgcaattaccagccaaagatggcatcatttactttagtggatcccgagccatggggcatttgcaactccaaattct
tgatcccaagggtcttttccgccgtaattcaattattccggagggtgttccagtacatttacagattacgagctcctgtattgcaggagtggccaacgat
tccgtctctacctcttcggagaatatggctgaaagcgaaaccagtcaatgcgggtcaaatgagtttctgtgccccctcctacgtgctccaaacgatcttg
agcatcacaacattcgtgtgatcagtccattgccacttgatcagctcatattaagtggatcaagcctcgagatccagattgggtaggatagttattcatg
aatatcaattatttgtcttggcagcatagagttgtctactaaagcgaatgacaagtggaatgccagctttgcgcatgatcttttcgcgaccgagcgagtt
gtcgagccactgaagtagtcctgtaatctgtcgctccggtgtttcatatccgggcttcatactaaaaagttccaatgcaaggcgagctagaaccataccg
aacgcaactttcttcaacgtctcagcatcagcacctgtaggtgggtccttgtcgtgtagcgcgaagtaagccttgagcagtgcagcaacctccgtgtgca
agtgttttaagctcacgcggtccataaaggatgggatcaactcaaaatcgattgcaaagctgagcaacaactcaaagctcaatccgaaaagctctgtctt
cgcaatggaaattgcggttgctgcactagcgttggggaaatgttgtgcactgtaaaattcgcaaatcgttccgagtgggcgttgctctcgacttaaaact
ccgttcatttccagcattgagaataccacttcttctcttttgtgggatcggttggatgatggtgggtacaagtgacagtgaactctcgcttcgttcgtat
ctctcgaggtcgaattctcattaccggggcctaagtgaagtgctagaccattcaaaatgcttttcatagctcgggcacagacttgagatggcgatccagc
gctggtactggaccttggagacaatgaacacgtcgacgatgatctgcttcgatgaatagctgggtgtatcaagggagtttgccgttgacgcatataaggt
cgaagatacagcgctacaacggtttgcagtacacgaaggagatcagagcgtggaaatttgcgtataccaaccagtgtcacagcttcattgaaggaatctt
ggctgaagaatcggaaacgtttaacatcagtgcccatgctcgtcgattttgaaggcgaagagtttctttttgtctttgcccacccggtaggtggagtccc
tggccgttgtagcgcgccattgaaatctttccgaatgattgagttcttccgattcgcttgggcttgagccaaaacaccagccaaaatgacatcaacatca
gcaggaagcacatttggagcttggaccaatccgctctcaatgaagaatcgacgaacggtagatacatggacaccctctcttgattcttcgatggaagtat
ccagcaactcgaacaccgatactaaactgctttgtatctctgaagtatcgatagaattcgggttatcattgaagtccccgtcgattccagtgtttatggg
gaaaacactgacaggtcgactagttgatgaatctgagctgattgtctcagtcaaatcggaagcaagcgtatcggtaggaagagagtttcggcgcaatatc
tttcgaggggcttgggtctgtttactgcctgctatcttggccaactcactaaacactccagggcgtcgggcatccatatcttcttctctcatcaagaggc
actcatgtccttctcgtcgacatgttgcaagttgttgcagaagttcagcctgtatgtaggatcactgttagcgaatagtgaatatttgtacgaaccaaaa
aatgcttactttttccagctcaagaatgtggacttgtataagcgcgttgtcccgttcaacttccacgcgttgcttgtcttgtttactctctcgagtgcgt
gccatgtactcagttcgcatatattccctttgctgtaattcgcgagccgtacttgaatgctgagctgcaagagactttgcctcttgaacggaatcattca
aagccaacgaaagttgttcacactgcatagcttctgctgaccgaagtgcttgttccacttggcaccgacgatctgcttcttctagagaagcctcaagatg
ccgcatacgccgaagtatttgttgatgctcttttccatggttcgtaactcgtgagctttgaagagatagcaacttggtttgctcctttgaacgacgaaga
actatacgaaaccgatcattcaactcgcggaaggaaagctgaacttgctgtaggtcacgttggctcgcttcgtacagagcttgccagtcttcagcttccg
tatccgaggcgcttggacgacgattatcttgttcttcacgcttgttagcttcacgcagagcctgccgttcttctgcacctttattaggttttttcgtagc
aggatctggattccacttgtcttgtgaacggactttctcgcaaatattggcatcgttaggctttttacacaaggcatcggcatgactatgatcaagtgca
ctcgctgtgcttgtaggagagctaagtgaactgaaaacggtgatcgggctgctgctctgtgattgctgaaggaatttcctaaagtatccagtggcatcat
ctgcaagtaactcgattgcatcgtcaccaagttgatcgctcctgtaatctaagctccgtactggatctactggaagttcgttatcactgccctcatccga
atgtgccgttgacttcgcagacgctgttgggcgtgtgtttatatgctggaattgaccataaccatcgtagtggtccgttggtgtaatcgatctggatcct
tttgcaggctaaacgagtttcctaaaagttcactggctggttcatccagtaaagtctgtaacctgcttaggacaaaagtcacatgtgcgctgctttcctt
gcttgcagcttggcaatactgtagcacctccacctgtccctttaaaactgttaacctagaacttggtgtcagtttcctaccaataaatgaaagtcagaca
gtgttgcgtaccgagcttttgttactttatgatcagatgaaggcgagttcttggcgatcatttgctgcagcgattcccacgtggcgggtcgcgaagcagt
gtacctagtagttttacaaagccatttgctgcctcattcgttgatagtccattatcagcgatgttccaaatattcagggagcacaatgatttctttactg
ctgaatacatagcaatactgttcatacagacgtagacgttataagatagaaaagaagaacgaaaagatatagcgttttacctgttaaggacagcaatggc
tttggcttgtacgagatcaactgtcggtagtgcacgcatcgcaccaagggcagctcgtacaacttcgtggaaaaccgtggcatttgcaccacggagtgag
acaccaactgaatcttcacggcagtctggctcaacacaaagaaagaagagtagatctaacgccgtaaccacaaactcagcctccccaccatggcgtaaca
gagctcccgagatcgcctgcaaaccaccctccctccttatacgaactttaccgtcttcctcaaacgccatctgacgcagaacttgacatcctcgaacctg
tacttgaagaacattttcgtgcgtgttcatcagcgcaatgcaagctcgaataacgtgcgagatctgcaagcttgggcggtttttgctgtccattgccaat
aactccaacgtctgcaacgatgtagccgccccgaacgctgacaaacgtaaagctggctcatccgattcgctacaacggacaattaaatctgcaacgccat
cgcgaaccagcgcttcacgctcgcgttcgcctcggttcgcaatcttaagcagcactagattgacgcacgcaaagaccgtcgtgaatctttcgtcggaagg
gagcggtactacatccacccaatagcttaaatcactcagaacggatcgaatgcacgctaacgtcttagtgaaagttccgtctccaacaattaattcttcg
ggccctaacgaggctaacaaaacctccagcgctctccacaaagcccgcgcctccgctactctctcgttgcgacgtacgctgtgtggatcatcgtcctcgt
ttgcgagctcccataagcgatctaatagcgcgtccattgccgcgagtgaggaaactatttttgcttttttgtcttcaacttaccggtttaaccgtcaaaa
agcggtacatgtagtagcattagacatgagatatcgatatttatacgaatcatttggctacttatgttgtatccactggagatatcgatatttatacgaa
tttagaggttcagttttctccatttggctacttatgttgtatccactggcatcgagcattctgcttcgagggtttattacgccgtcgcattttagctagc
agtacagccccctgcctcacactctgggcgcgatggactcacatggtgatgactcttctaagtctacggcaatgcctgcacctgtaaaagcttcttctac
cggtgacatcgacgactttgaagccatgagtctttttggggggccgtctgagcctccgcctccccccgcgccggtcaagtctttgtcaacgagcgccctg
gacgaccatgagagctacgatctcttcggcgtaggccccagtatccctgtggccactgtagtaacgaaggaggctgcgcccatggccagcactgcaccag
tggaagaaggaggtgcaggtgaggtgcctgtgcagcctccaggtccagtgtcccctgccaattacgatcttttcccagcgttgacgtcggcggacaaaca
aggggaagtaaagccactagaagacgagtcggaactctttccatcatcgagaggcctgaagcacagtgacagtagtagcagcactgccacgggaacgatg
agtgccgacgggtcgttccgaggagagctgccgcgtgccaatagtaacgcgttgcaagtggcccaaacggaagaacaacaaggatcacctccatcgtata
agatggcaggcaatgcactggatattgtggcggtgaagaacacggagggaaagtatcttacgacgtcgtggcatgtatcgttctcatggtcacgcttccg
ctcaagctatgcaacaggcgtaggcgacatggtgagaatcttggtgacggcaaagagatgccgaccaaaatggagctgcaggaacgcggtcgctgcactt
tcatcacgagcggtgttatgattcctccaggagacttgtgcttcgctgatctgtcggacgaacatccgaaccacgtgcgttttgaacactaccaaaagta
cacgaatacagtccggtatgtggatgcaaagctgcatctatgggggccgaatgaatcggtagttgtggtcgatttggacggcacacttaccatcagtgac
gtagagggccacatccgcacgttgcgtctagggcagtacgactttctacatgccggggcctgcgacttcttcaccaagctgcacgaactgggcatgcgga
tcgtgtatcttacagctcgcccacttgactgggcttccgcttcacgaacacacttggagaatgcaaagcagcaatcgatttcacttccgccaggagtcct
catcacgaattcaactggccttacgggtgcgctgtttactgaagtcgtgaacaagacaccgcaccttttcaagattcaagtcctgaacgagttgcagctg
acgcttatccatgctggtcgcattattgagcacccggtatttgttgcaggatttggaaatcgccccaccgacattgtcgcttatgaagaagtggggatgg
atcccagccttatcttcatgctcgacccgtactcaaacgtgaaggcggtatccgacccacgtctctacgagtcttacagcgatccaaacgtgctgttgtg
gttgctgcccaagcttaagcaccgcgtccccattgagaaggttggccgcattgatgactacactgtgcgagaacttgttctggctgaagatcgtgagcag
cttcgcatggcggaaatgcaggctcgtcgactacaacaggaagaattcgagcgtgctcgccaggaagccgatcaagctcggtacgcttcaagcaacgctc
ttcgtgccagcagcagaagtctctccagataatgtaccactgcctcgtattatactacagcacctacgtacagttatggctaaaattcttcacttggcag
tggataaatttcattgaatttgtttaatgcgtacctaaaatcgtcatggtgcaatcaaagaagatcagtatactagatgttagaattgcttttcatttca
ggactcaaccatgcctttgacaagtcgtcgctcctggctggaaagcgtccacacacagctccgacgccagagcacgcgctcctcagcgcatcaacagcgt
cagttcgaattgctggtgcctgcgttgcagactttccagcgcctccgcggccattttgccgttccgttgcgcttcatcatcccaagcagccagagttcag
agggtgagcaatggcccaacgagctgcaggggatgaagctaggtacaaccatctcgcgatttctgaaggcttccgcaatggccaagaaacccggaagaaa
acgaagtttggacgaaattcgagaaaaactgcaggagcttgggctgccagacgttgtagattggaagcggttcctgtgggaagaggtatctgtaccagcg
atgcggacatacaactcaatccacggggatctcttcgtgccggtgtcgtttacggtacctgttggagatgttatgtggccatgctcgacgtgggggtaca
agttgggctactggacaagtgagcttcgtcgtcgcaaagataacctgccacagtatcaacttgaggatctgaacgagctgggcttcaactggagtgttca
agaaggtcgttggaatcgctatttccttcctgcgctgcagaaatatcacgagttgtatggcgatcggcacgtaccccagcgtttcgtagttcccagcgac
gacccggactggccggcagagttaagtgggtatcgccttgggcagaaagtgaacaatttgcgctgtggaaacccgatgaacaatgtggacgagttgcaag
atatcgacttgctgttcaagaattggatgctccttgagacccttcacgaagttagtgaaaatggcgaagtaggcgccacacacttagaccaaaacgacga
agaggcaatgcaccagtagatttgtacaagtggagaacacaacgagaaatgttttcacttcgtggtgcacttcaaattgaatgattcaattataaaatat
cataacgacaacttattgtccttcttgcctagagttgacaccagctaggcctatcattccatcttgccaccaccaagaagtcccaccgctcaacactcca
actgctcggatcgctcagtcagctcgtccttggcataccaggatgcgttttacagcgatgggactttagcttcagatgctcgagccaagctgcacgatgc
gcgggtaacacggcagagtgaggaagtccaccatgtcgtcgcccgtcagcaccttgcccatgatctcgccaccaagtgtccatttgttgcccggagcggc
gttcagagaccgcttgttaacgcactnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnaaatccgggagaacaccagcgtccaactccttctggcgttgcacacgcgcggccagtagcgcctgacggcgtgg
ctcgaactgttcatgtaggaaggcgaggaaacgcagcgcgtcgggcgtcaagacacggcggaaggcgtccgaaacgtggcccagcacgcggacgttggcg
gcgttgacgttaagctctgacatggcggtttcagttgatgtggcagggacttcttgctgtgttttgtgacagtcttgcacgctcggaggcaaattgcgga
atgattttggtcttttgcgatcctgaggggctattgcacctcgaacccgacgtgacccgtacgcaatgtggcttcaacatcgagtttcgtcgcaatttta
gccaataagcgaagatgcttgatcgacgtcgccagcgtcacggtctcctgtacaagggggcatacaaaaaccaaatcaaaagacgaaagaccatcactct
gttattgcgtttaacttccaccgtgttgacaatgccttgcgagccacggcgatacatgtaccgcagcacatgctgaagttcctgtgcaggtgatcggagt
gattggacgtgcactttctcttcgccaagcgatgcatgggaaaacagtgttttcgaaacacccgtgtggtgaggaagatgctatgaagttaaacatggcc
gaaccggaatacaagcggtcctggcatccctactattttgctaagcgcacggcgggcagactgtgtgaatcgtttaacagtgctacaaattgtatgccag
gttttccgtgccgaactcttcgcaccggaactgcacttatccctgacactgttgcgtatcaggtacttcccgagggcgtctttgattaggatgccgatgt
cgccttgtgaatgaatgagcttcggagctcgtgcccgtacaagtgtaatggttaggagtagctctacatcgagcagggcagatggattaacgacagcggc
aagatcatagagctaggacatcgttagcttcagctattaataagtagacaaccttggtactccatttccgattcggctttattcttatgagctggtcgcg
cctggcagactgaagcgagatctttagagaataggctatctcatgatctcctatggcatctgaagactccaattcactcaatagccgttcgattgggtgg
gcaaagcaggcgccagtttagggatacaaataccattgcaacactcaagccccatcgtcattccggttcgacttcatagcatcttcctcaccacacgggt
gtttcgaaaacactgttttcccatgcatcgcttggcgaagagaaagtgcacgtccaatcactccgatcacctgcacaggaacttcagcatgtgctgcggt
acatgtatcgccgtggctcgcaaggcattgtcaacacggtggaagttaaacgcaataacagagtgatggtctttcgtcttttgatttggtttttgtatgc
ccccttgtacaggagaccgtgacgctggcgacgtcgatcaagcatcttcgcttattggctaaaattgcgacgaaactcgatgttgaagccacattgcgta
cgggtcacgtcgggttcgaggtgcaatagcccctcaggatcgcaaaagaccaaaatcattccgcaatttgcctccgagcgtgcaagactgtcacaaaacg
cagcaagaagcccctgccacattaactgaaaccgccatgtcagagcttaacgtcaacgccgccaacgtccgcgtgctgggccacgtttcggacgccttcc
gccgtgtcttgacgcccgacgcgctgcgtttcctcgccttcctacatgaacagttcgagccacgccgtca