Description :
From Genome Similarity Track
Location :
Scaffold_9:136436- 137519
Transcript NameFunction/comments
Physo_339871histone acetyltransferase, putative

Sequence
1083 bases(100 bases per row)
GGTCACTGCTCCTCCAACGATTCTTTTTATTACTAAGACTATGCAGAGATTAAACGTGATCTAACCATGAACAGATTGAAAAATAGGTAAAACTATTACT
TAGTAAGAGGATCGAACTCACATATGTGGCAAAATATGGAGATGATTTGTGGTTAGGAGTGAAAGGCTAATCAAACTCAGAGATAGCTGGTTTTCCGCGA
AATCTATTGAAGTAGAGCATTTAAAATCTTTTTTTGGGGTAGAGCACACGATTTGCACTACCGGTAGTCTTCACCGGACTCATAGCTGCTTTCATCCATG
GATTTAGTTAGTCGCTGCCGAGTATTCGAACATCGGACGTTTGGATGGTGGGAACTTCCCACTGGGAAGAGTAATGAGCAACATGTCGACGGTGCTGAAA
TATACCGAACCAACATTTCATCAATTCACTTGACCAACTGAAATGAATTCAAGCTGCATCGTACTTCCGGCTGGCCACTTGTCTACATAGTGTGTTGAAA
CAGATTCAATATATCGAGCTAACGTGTCGGTGACAAACGATCGAGTATTTACGTGTGTATGTCAGCGCGCAAGCCGTATGCTCGATGTTCCTCTCGGGCT
GAACTCGGCCGAGCGCTGCGTCAGTACAGAGTCTGGCAGCAGAAGCTACTAGCGCTCGTGGACCTACGTTCGCTACGCCAACACTTTTCACAAAGCTCTG
CAGAAACAAAGTATGTGTCAAAGCTTGAATTCGCTCACACCGGGCTTGCACCTATGGGTGTTACCTGGTCTGAATTCTTTGTTGGACGAACTCGCGCAGA
TCCACGGCGGCCCTGAAACCAGCGACAATTGTCAGTGTAATAGTTCGTTAAAGCAGCACAGGGAGGCGTACTTGTAGTAGTTAGTGTCGGGTGTGTTGTA
CGTCGTGCAGTTGTCAAGCATTTTGTCCAGGTCCGCCTTGAATGCAGCTATGGAGACGTATGCACCACTGTCGATGCGGTTGTGGATAAGGTGCAGATCA
ACAGGGTCTTCGATAAAGTCTAGGTAGTCGACCACGATGGAAGTATCTACGGGCTCGTGGAATGGCCACGCACTGCGGTGGCT