Description :
From Genome Similarity Track
Location :
Scaffold_21:136427- 140311
Sequence
3884 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTAGTAGCACTCGTAGTCAATCCACGCCAACGCGGGTAGACTACCTGAACCTTTCTGAAGT
TCGTGGATAGAAACGACGTCTCCCACCTGAACGACTCACAGTTCGAGTCGGCTTGGAAGATGGCTGGCATCTTCGGGATCGAGACCCTGTAGAACCTGGT
GGCGTCAGAACCGGCCGAGCATCTCGAGCGCATCTTTGCGTTTGACGCCTACGAGCGAGGGCTCACCGCCCGCCATGTCCATCACACCTGAAGCCAATAC
GGCTGAACGTGAATCTGCACGAAGGAAAGATAGATGAGAACCTTCACTTGTGAGAGGTAGAGCTCGCGATGGACGCGGTTCTGCTCACGACCGAGCAACT
ACGCGTCGCTTTTGCAATCCCCAACCTTAGTGGTCGTGCCAAGGGTTAGGATTATACGTGGAATACGGCATCGCCTGTATGAGTCACATCCTGGGATCAA
CTATGCGAGCAACTTCGAGCGGCGTTCCTCCCGGCGAGCTACGAGTACCGGCAGCGCTCGCGCTTCGTCTCATGCAAGCAAGGAAGGCGCGACCGGCATG
AGTATATCCAAGAGATGTGGAAGCTCACGGTATTCCTAGCGGACAACCCACTCAACGAACACTTCAAGGTGACAGTGTTCATCGACGGCCTTCAAGTCCG
ACCGGCGCGCACTCCGCTGTGCCGGGTGCAGACAAGAGCCCTCGGAGAGGCGATCCAAGTGGCTCATCAAGAAGAATTTAGCCATCACCAGGCGCGAACG
TCGGCCTCAGCGTGACCAGGGAATTCTGTGTCGAATACCGGTCGAGCCATCCCCACCGGACCAGTCTCTATCGAGCTCGGGTCCGCCGAACAGTGCGACA
TTAGCTGCTTCGGCTGCGGGAATCTGGACCACTGCAAGCGTGACTGCCCCGCGGAGAGACACCGCAGGCACTTTCCTAAGCCCATCCGCAGGGGTCGCTG
GCAGAAGCCAGGATCCCGGGTCAGGGGAACGCGGGAGACCATTGGGGCGGGACGTCATACAGAGAAATAATTAAGTCTTCGGGAGAGGTACGCGGGTGGC
TCGTACCACGGTGACTTAGTCCCTGAGAGTCTTTGCACTCTAGAATCGGCAAAGACCAGCGGCGGGCTGCTTCTAGTACTTGAATGGGTACGGTAATACG
ACCGCTGCCTTAGAATCGCAATCGGTTCTGGGTCGTCGAAGAGCTTCGCACGCCGCCAGACGGCTGCTCGTAACAGCAACAAGTTTTCCGATGCTTTGAG
AGAAAGCAAATCCAACGGGACAATGCCAGTGTAACTGGCCGACAGAAAGGTGGTCACTGTCCCCAACATCCAGATGGGCCTGGCAGTCAAGTTTGAAGAC
TTCGACAGCCCCGAACAGTTTACTGTTCTCGATATGGATCCCTACGATTTGAACCTGGGCATGCCCATGCTCGAGGAACACAAACCTGACTCGGCTGGCA
AGGCAAGACAATTGGTGCCAACCGCCCTGCGTTTTTTGAAAGAGCTTTGGTGAGCCATGTTCCCAACTCTGTCAGGACCCGCAAGGGCGGCACAGGTACC
AAAGCATCCAACGAATGCTTGAGAGTCGTCGACATATAATATGACTCCGAGGAAGCCGTCAAAGCTAGGTGGCGCTGGCCAAGTGGGTAAGGTAAGTCCA
CAAGCGGGTAACATAATTCCGCAGATAGCTGCAGCTGTCACGAATACTGGAAATAGCGTGTTCAAACTGGGGCAACATCGCTCTACACACGGTCGCCCAG
ACCTTAACTGAAGAGGACAACGCTGGATACGCTTACTCTGTGGGTAGCACAGTGCCACACGAAGGTCGCTCAGATCACAACTGAAGGGGAAGACGCGGGA
TGCGCTTCCTGTGTGGGTTTCAAAGTACCACACGAGGCCTCCGGTGTCTCGGATGTCGGCGCTACGACATCCCCAGACGTGGATAACGAAGTTTCACATA
ACGGTCGCCGTCGACGACGACGCCACCGCAGAGAGTCGGATCTGAACCTCGTTCAGATCGACGTCGTTGCAAGCGACTCGGAGTCCAGGACCCGGGCTCC
TCCGACACGACCGGTGAAAGCGTGCTATCACATCTTCGATGGCAAGACCAGGTTACCCATCAAGGCATCTGGTGTCCACTTGGAACCGTTGTCAGAGGTT
GCAGATATACTGAACCTCGAGGAAATTACGGCCGAGTCTTTCCGGGCCCACTTCAAGGTTGAGGAGGTTGCCGAGATGGAGCTCATAAGACCAGAGACCG
CTTGGGAAGACTTGAGCTCCTCATTAGTCTTAACGAAGACGACCTAGAGGAGTGGAGCAAGCAACGTCAAGCGCACTTAGGCTCTTAAATCCTTAAGAAC
CCCGAAGACCCGGTGTATCTTTTGGCGACGGGGTACGCGGACGTGGTGAACTAGCACCCACGGACCCAACTACCACCGGACAGAAACAGCATGAGATCAA
TCTCGTGTCTGGCACAAAGAACTGTGTCACGGGACGATGGCCCCGCCACACAAGCTGTGCGAGGTCATTGATGCCTTCTTCGCTGCGAAAGCATGAGATC
AATCTCGTGTCTGGCACAAAGAACTGTGTCACGGGACGATGGCCCCGCCACACAAGCTGTGCGAGGTCATTGATGCCTTCTTCGCTGCGAAAGTGAAGGC
AGGCATGGAGCGGGAGTCAAAGGCCCCGCACTCGACTCCAACTTACTGCGCTCGGAAATCGAACAGAAAGTGGCGTCTGGTTCATACTTATAACAAAGGG
AACAACGCGACGGTGCCGGATCAGCCAACAATCCTACGAAAGGATGTGTTGCTGAACAACACGGCCGAATACGTACTGTACAGTACGCCGGATTTAGGAG
ACGGATACTACCAGAATATGATGCGCGAGAACGACATTCCGCTCACGTGGTAAGCACTACAAACGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGAC
CTGTCTAACGCCGCGGAGACAATCAACGGCCTGGTGACGCAGCTGTTCAGGCTAGTGCGTGCCTCGTACACACGCACTTCGACGACATCTTCGTCCATAT
CCGTACCGAGAGAGACAAAACGGCCATGGAGGTGCATTTGGGGCACCTCCGTCGAGTGTTGGATGTGATGAGAGCGAACAAGCTCTAGGCCAACATCGAC
AAGTGCGGCTTCGCGTCGCCAAAGCTCAAGGTTCTCGGTTGCTTCGTCAACAACGTCGGCGTTTGCGCTGACCCAGACAAGGCCAAGGCCATTGTAGCAT
GACTGGCGCCCCGATACCAGAAGGATCTCCGAAAGTGATTGGGCTTGACCAACTGCCTTCACAAGTACATCGCAAGGTACACGGGCCTCGCTACTCCCCT
GTCGGGCCTCCATCAGAAGGACGCCGACTGACGCTGGGACCGAGAGCACAAGGATACCTTTGACAGCGTCGAGACCAGTCTCCAAGAGACTCCTCAGAAG
ATGTACCCGAAACTTCACGAGGGCATATATCATTGCCAGGAGCTCCTTGTCGTGAGCAGGGTAGTTCCGCTCGGCGGCTTTGAGCTGCCTGGACTGGAAC
GCGATGACTCGCTCGTATCCAGCTGCATCGGCCTGCAGCAATGCCCTACAGATTGCCTAGTCGGAGGCATTGCAGACGATGCTGAACAGCTTCGTCTCGT
CCGGCAGGGCTAGGACACTTTGGGATCTACACAGACCACGCATCCTAGCGAACGGCGACGAAGGCGTCTCACCTCTCCCAATAGATGCTGAGGTGGATGT
CCTTCTTTGCGGCCGCGTTGCGTAGAAGACGAGCAAACTTAACGTGCTTGCGGACGCCTTATGTCGGCGTCCGGACAACGCGTT