Description :
From Genome Similarity Track
Location :
Scaffold_11:136419- 141103
Transcript NameFunction/comments
Phyci_346366Hypothetical protein
Phyci_62797conserved hypothetical protein

Sequence
4684 bases(100 bases per row)
CCAACATCTTCCGGCGTCATGATAAAGCAGGAAGTCCAGACGAAATCTGACGTGTCGGGAATGGGTGCGATGACATCTTCTACTCAAGCTCCTGCGTCAG
CGGTAAAGGAGGAATTGACCATCAACCCCCTTACGATGAACAATTCAAAGTTGAACGCAATGATGGTCGAACACCGCCGAATGGATGCTAGCACGAACTT
GCCTCTTCCAGCTGGTGCAGTGGGTACACCGAAAGCACTAACAACTGATTCAAACGCAAAATCGGTGGGTGCGGCCACGCCAGCGCCGCCCGCTTCTTCG
GAAGTACCAATGTCCGTGCTGAATGAGCTTAGTAATGAGGATCTAGCGTCTCATGTCGACTCATTGATCAAGTTCTACAACGCCACCGTTTCGCCGACGA
ATCTGAAGAAGAAACTGGAAGTGATTTTGAAAGGTATGATGGACCACAAATTCGGATGGGTGTTCAACACTCCTGTGGATCCTGTTGCTCTCAATATTCC
GAACTATTTCAAAATTATTCGAAAGCCGATGGATCTGGGAACCGTAAAGAAGAAACTTGAAGTTGGCATCTACAAGCACATGGAAGAATTTGCTCGTGAC
GTGCGAACTACCTTTGAGAACGCAATGCAATACAACAGCGAGGACCAGGACGTGTACAGTCTTGCGAAGGATATGCTGTCCGACTTCAATAGCGAAATGC
GCAAGGTGGCTGCTGAAATTGAAGTTGACGAAAAGGCTGCACGTGCGAAAGAGAGTTCGTGTCGACTTTGCGGAATTGAGCGCATGGTATTTGAGCCTGC
TGTGCTGTATTGCAATGGAGAATGTAATAGCCGTATTCGACGGAATTGCTACTATTACACTTCAGGTGACAACAAATATCACTGCTGTCATCAGTGCTTC
GCTAGCCTGCCCGAAACTGTAAAGCACAACGAGGGTCGCCAGTACAAGAAAAATGAGTTGGCACGCAAGAAGAACGACGAGGTTCATGAAGAACCCTGGG
TGCAATGTGACAAGTGTGAACGTTGGGTGCACCAGATTTGTGCTCTGTTCAACGGAAAGATCGACAGCGAGAAGAAACCACAGCTGGTCAAGACTGAGGG
CGGTCAATCCACTGATAGCGGTGATACGTCGTCGTCTCCATCTTCGTCTGGCGCGAAATCCACCGCAGTCACCACGACTACAACAGTTGTCAAAAGTTCA
TCGTCGTCAGGGTCGAAGGGAACGGTCCATTCAATTACAACGTCACCTGGCAGTGAGTTTTTGTGTCCAGAATGTTTGTTGGAGCACCGCAAGAGCGAGC
CTGAAAAGTATAAAATAGGGCGGCACGCTTTTAGTGCTAAAGATCTACAGCGCACGAAGCTGTCAGATTTTTTGGAGCGCCGAATCAACCAGTCTCTTAG
AGCGGAACGGGAAGACGAGGCAAAGTGGACGCAACGTGACGTGAAAGATGTGGAGACAGCTGATGGCCTTACTGTGCGTTTGGTGTCGAATATTGAAAAG
CAGTTGATGGTGCGCGATAAAATGTTTCAGCGGTACAAGGACTCGCACAAGTATACATCGGAGCACCGATTCAAGTCCAAGTGTATTTGTATGTTTCAAG
AGCTGGACGGCGTATCGGTCTTGTTGTTCGGCATGTACGTCCACGAGTTCGACGAGCAAGAGGCAGACTGCAACTCGCGTCGTGTGTACATATCCTACCT
GGACTCAGTAAACTACTTTAAGCCGGCTCATCTTCGCACGAAGGTGTATCACGAACTGCTGATCGCGTATTTTGACTTCGTCAAACAGCGCGGCTTTCAC
ACGGCACACCTATGGGCTTGCCCGCCTCTCAAGGGTGACGACTACATTTTATACTGCCACCCAGAAGCGCAAAAAACACCAAAGTCGGATCGTTTGCGCG
CTTGGTATGTGGATATGTTAGTCAAGGCTGAAGAAGAAGGAGTGGTGTGGCAAATCACGAATATGTATGATGACTACTGGCGAAATGACAACACGCCTTG
TGCGCTGCCGTATTGCGAGGGTGACTACTGGGTTGGCCTGGCAGAAGACTTGATCGAGAAGTTAGACGCTGAGAAACCGAAAAAAATTGTGAATAAGAAG
GGTTCTAAGTCGCACAAGCGCAAGAATTCCGACACAAAGAAGGCAGCGAACAAGAAATCCAAGTCAAAGAAGCCAAAACGCCGAAAGACAGCTTCTGGCG
GAGAGGCATCAGGCGATGAGGATGACGACGACGACGCACACGATGAGAACCCAGCTGCAAACACACGTACACTCACGGTCAAATCGTTGGATACTCCTGA
CCGGAAACTGTCGGACCCATTAATGCACAAGTTGGGTGAGGTGATTGAGCCTATGAAGGATGACTTCCTGGTGGTGAAGCTCGTGCCGTGTTGTCGCGTG
TGTAACACGTCTGTGGTGAAGGGTAACCTGTGGCTCGATCACAGTGTGAAAACTGAGCATGGTCTCAATCCGAAGGTGGTGCAAACTGCGCTGTGTGACG
GATGCTACCAGAAGCTCAAGGTCGTGTCAGCTGCAGGTTCATCGGCGGCCCACCACAGGCTACAGACGCGGATAAACGCTTTGACTAAGGAGACTGTGGC
ACTGCCAGAGCGCTGCACTGATCCGGACGAAATTAACGACAGTGAGTTTTTCGACACGCGACAAGCATTTTTGAGTCTGTGCCAGGGCAACCACTACCAG
TTCGATGAGCTCCGGCGCGCCAAGCACTCGTCGATGATGGCTTTGTATCACCTGGGCAACCCGAATCCGAACGCCTACGTCTACGAATGCAATGCGTGCA
CGCGTGATATTGTCGAGGGGAACCGCTGGCACTGCCACACGTGCCCGGACTTCGACGTTTGCGACGCCTGCTACGCGAAGGAGAAGCACGAACACCCGCT
GGAGAAGGTACCGACAGGCAGCACAGGACCGGCCATGCCTACCCAACCCACGATCACAGCAGAGCAGCGCGTGCTTCGCGAACAGCGTGCCAAGAATGTC
CGCTTGCACATGCAGTTACTGGTTCACTCGAGCTCGTGTGCTGACGGCAACTGCGGGTCTTCGAACTGCGAGAAGATGAAGGAGTTGATGCGGCACGGAG
CGCAGTGCAAGCAGCGGGCGTACGGTGGCTGCACAATCTGTCGGCGCGTGTGGGCGCTCCTACAGTTGCACGCACGGCAGTGCCGCCAATATGAGTGCAA
GGTGCCGCGCTGCCACGATCTGCGCGAACATGTCCGCAAGCTGCAGCTGCAGCAACAGCTCATGGACGACCGTCGTCGCGCCGCAGTTACTCAGCAGTAC
CGCCAGATGCAGAACGAGCGCCAGCAAGAGCAGCAGAATCAAGCACAAGGCGACGAGCCCATGCCGCAGGCATGACCGACCTACCGACCGGCTTAAATCG
AGCTTTGTGGACACGAAATGTCGAGTGTAGCATAGGATAGGGCAAACCATACTAAATGTAGATGTGTGTCAACGTAGCTTCCGAGTGTTGGCAAGCAAGC
AAGAGGTAGGATAGGATTGTATAAACCACTGGTTATCTGGCTAAGGTTAACGACGAGCTACATACCACTGCCACCCACCCACCCTCGGCTTATCGTCGAG
ATGGAACTCCGCAACAAAACGCTGGATGCCGCCCAGATTTACGGCCGTCGACTCTTCCAAGTTACGTCCAGAGCCGCGTGCTCTGCTCCTGCTGAAGTTC
TTTGGACGCCGTCAGAATACAACTTCGCGTGCGTAGCTATCGTCTACTTGCGTGCTGCAGCGACGCGGTGAGCTTCGGGAGTGCCCCAATTGCCCCGATT
CGGCGCGTGTCGTGGAGCGCCCATTGCGACCCCCCCCCACGCGAAACCTCAACGCGCTTATCCCAGCAAACCCTTGACAATGATTTTTTACGCTTCCATC
ACAAATTCCTGCCGCCAACGTGTTTGCCACCGAATGCCAACCCTCAGGGTCTCACAGTCGAGCTATGGCTGATCTTCGAGCGTGTGGAAGATTTGGCCGA
GCTTTGACGCAACCAGGACGACAAGGAGAGTTTTGTTGCCATCGCTCGAGTTTGGTTTTGTTGTTTGAGGATACTGCCGCAGGCATCCTTTGTCACTCGA
AAAGTGTTCCGACTTGCTGCCACGCCCATTTTTCACGTGAAGAGGAACTGTTATTAACGAGTACGTTTGTGAACTTTCCGTCAATCGTGTCCAATTGCAT
GGTGGCACTAATGAGAACTCGGCGTACATGCATCGTGTTCTTCAAAACTGCAGGAACAACGAAGTCGCAGTCCATGCTGCAGTTCGGCTCACACCTCCGG
AGCAAAATACTGCTTGAAATGAGTGACAATGTTCCAGAACAACCGGAGTCGCGACCGCAACGATACAAGTGGCAACCAGAAGACGCTGTGGGGAGTCTGT
TTCAGCATACTGCTCATTAAGCTCAAGGAGGGGGGGGGGGTCTACAATGCAAGCCAGCAGCCTGTCGCTTCTTCGCTGCCACATCTAAGCTTATGCCTTC
TTGGCGCCGAGCCGTTTCTGACGACGGCGGTGGTGCGAGCACGGGCGCTTGCCGTGGTTGGCCTGCGGCAATTGCAACACGCGTTAGATCCCCTCTCCCA
ACTCCCGCAGCACTCGACAAGCCTCTCTCTTTACCTTCTTGGGACGGCGGGCGTTCCGGTTGAGCAGCTCCATGGCGACGGGCG