Description :
From Genome Similarity Track
Location :
Scaffold_1:13640- 18168
Transcript NameFunction/comments
Phyag_g7pyruvate dehydrogenase E1 component subunit alpha
Phyag_g8hypothetical protein PHYSODRAFT_554387

Sequence
4528 bases(100 bases per row)
AGGCTTTCATCCATCATCTCGCTGCGCTACTGTGCGGAATGATTTgatgcagcgacgtcatTGGTCGAGAGGGAGGGGGGATTCGCACTTAGCCGCGTAC
CCAGCAATGCGCGGTTTTGCGGCTGCTTGGAGCTCTCCGTCAGTCCTCAATCCTCCACCAAGCAGAAAGGAAGCCGTACCGATGATGATGCTCCGCCGCT
CCACCGCCGCGCTGGCCCGCAACGCCGCGCCCGCCACGTGCGCcttcagcgccgccgccaacgccTCGGGCGAGGCCACGTTCGAGTTCGCGTCGCCCTT
CGAGCTGCACCGTACGTGGCGTCAGCAGCGGCCACTGTAATaacaggcagcagcagtagctaACATTGGTAATGAATTAATAATCGCAGGTCTGGAGAGC
GGCCCCGCCGAGTTCGCCGTGACCAACCGCGAGGAGATGCTGAGCTACTACAAGATGATGTACACGATGCGCCGCATGGAGATCACCAACGACAACGAGT
ACAAGGCCCGCACCATCCGCGGTTTCTGCCACCTGTACGACGGCCAGGAGGCCGTGGCTACCGGCGTGGAGGCCGCTCTGGAGCGCACGGACTCGTGGAT
CACGTCGTATCGTAACCACTGCATCATGCTCGCCCGTGGTGCCGAGGTCAAGGACGTCCTGGCCGAGCTCTTCGGCATGAAGGACGGCGCCACCGGCGGC
AAGGGTGGCTCCATGCACTTCTacaagaaggagaccaaCTTCTACGGCGGTCAGGGTATCGTCGGTGCTCAGGTGCCTGTGGGCACCGGTCTGGCCTTTG
CCAGCAAGTACAACCACAACGGCGAGGGTCTGATGCCGTGCGCCATCACCATGTTCGGTGACGGTGCCTCCAACCAGGGCCAGGTCTTCGAGGCTGCCAA
CATGGCTGCGCTGTGGAAGCTCCCCATTATTTTCTGCATTGAGAACAACCACTACGGCATGGGCACGTCCGCTAAGCGTTCGTCCAACAACACGGAGTAC
TACACCATGGGCAACAAGATCCCCGGTATCAAGTGCGACGGTAACGACGTGCTCGCCGTGCGTGAGTGCACCAAGTTCCTGAAGCAGTGGTGCGGTGAGG
GCAACGGCCCCATCTTCGTGGAGATGAACACGTACCGTTACCACGGCCACTCCATGTCGGACCCCGGCGTGACGTACCGTAACCGTGACGAGATCTCGCA
GATGCGCGCGTCGCGTGACCCCATTGAgctggtgaagaagcgcatGATCGAGGCCGAGCTTGCTACGGCTGACGAGATCAAGGacctggagaagaaggtg
cgtGCTGAGGTCGTCAAGGCCAccaaggaggccaaggccTCGGGCAAGCCCGACCTGGCTACGGCTTTCACGGACGTGTACACGGAtggcaagggcaaga
acgAGTACCCGCCCTTCATCCGCTTCCCGGACTACGCCAAGAGCCTGTACAACGGCAAGCCCCAGCAGTAAGCGCTGAACGCAGGAATGAGGACACACAC
AGCGGCGAGAGGAATATCACCCCTCTTCAGGACAAAGCGCCTCGACAAGCGGTAGAAGCTGCGCTGCGTCGCCTCGTGTTTCTCTATTTCAGCGCTGTGC
AGTGCCTTAGAACCCCAGCTGGCATCGTTGCTTAGCTCTAGGAACAGTCTCGTTAGCTTTGCCACCTCGTTAATACCGGCTGAATATGTAAACGCCCAAC
GCGACCACATTCGCCTTGAACTTGTTGTCGACAGCATTTCCAGCGCCATGCTCTGACGATCTCACACCTTCCTCCTTCGTTGGGTGAGCGTGGGTGTGCA
GTGCACTAGCATCGTGATCGAGCATGTTGCACCTCTttgacaccaagcagaaactGATTAATCGGTCTGGAGTTTGCTGCAAGTCGAACTAATGCTGCTC
AATTCCCTTGTTGAAGCTTACTTAATACTTGTAATAATGCAAGTGCACGGCCCACCCCACGTGCATGTACATGCTTCTCATCCATATACTGACTCACATC
TGCACTACTTGTACACTACTTGACCACAACTAGTTCTCGGTCGGCTGCCCATGTGCGTACGTCTTGTTGCTTCTGGTTTCCCCCGTTGTCGTCATATTTC
TTCCGACAGTCTGGAGTAGACAGTGGTATAGCTTAGTTGGAATACAGCAcggcaccagcacctgcaccCACTTCGAAGTCACTGCCATTCCGGCGGTGAC
GAGGTCGACGACGCACCACTGAACTGTTGCTCTTGGGGTCGTTGCCGCCGTTTCGAAGCACTGGTGCCATGATCTCGTGTTCCTGTTGCAACGCCACCAC
GCGAAAGTGCGAAAGCTTTCGAGCTTGCTGAGCTAAAGTATGGGCGTAGTTGGCAGCCACGATAATGTGGTTGGCGCGTGCCACGGCCTCATTGAACTCG
AACTTTTCCTCACCGTCTTCGAGTACCGGCGTGTCTTGGTTGCTCTCGGGGTTGACCTGAATGCGCGAACGAACAGTGCGCGTACTCATACCGCTCTTCG
ATGTAACCCGTTCATGCATTCGTAGTGGTCTCGTGATCGCATACGTGGGTGATGTAGACGAagtcgacgtggtggactcgtcgtccgtgtGGTCGTTGTC
TTCCGAGCCATCTTCAGGCTGGCGATCGGCGTTGCCCATGCGGATTTGGTGTAAGCGGAAGGCTTCAAGCGAGATGGCCAAGTCTGCTGGGCTGCCACGG
CGTTTAGCTGCAAACAGAGCCTTGTTGCGCATCACAAGACCATCGCTGAAGGAGCGACTCGGGAAGCTCGCCTTGGGCACACCGATCGATGAACCTGCAA
CGGTGGCGCTTAGCCCGTGGCCGTCATCGGAGCCTGACGAGAACGTCTTGTACTCGATGAGACGCGAGCGCACGGGGTCAAGGAGGTTGTCGTACGACCG
GCGCTTTGGCGGAGTATCTTCCTTAACGTCGGATCTGGGGACTGAAAAACTTTGGGCACGACCTAAGCGCTTCGGCTCGTTCGCGTCGGGGAAGAACTGG
TTCGACCCGGTGGTGGAACTGAACGATGGAGTACCAGGCAACTCCAAGCCACTTGCGGTGTTACGCGCGTTGCGACGTGATTCAATGACGCACGCTGTGC
AGACTCGTAGTTGACGCTCGCCGACGTCGGGCACGTGGGCACTACGAACCGAACTGCATGAACTGCAGCACACTTCTCCACACTTGAGGCAGTTGtagcg
gcgacgacgcacacAGAACTTCTTGTTGCACATTTTGCAGTGATCCTGTTCACTCATGGGGACCACTTGCTGCGGAAGCACGATCTCCTCTCGACCTACA
CGAAAGTTCTCAGTGTACTTGAGGATGCCGTTGATGCACTTCTCCACGTGCGACTGGATGGCCGAGTTGGCGATCCACGCCGGCATATCGCCGTTCTTGT
CGAAATTGCACGTATACGTCATGCGCAGCTCACCTGATCGCTTGGTCGAGTGATACATGAAGCCCATGAGCGGGACCAGGTCACGCGTGAACTTGGGCGA
CTCGGCGTATTTGGGGTACCCTGCAGGGGTGTCGACGGATTCCATGATGCGGAAAGCCGTCATCTGTCCCTGAGCGTCCTCGATCATGTCGACATATTCG
AGCATGAGCAGGTCGCGGTCCTTGGCGAATGGGCCCGAGCTCTTGAAGGCGGCCCACTTGAGCGCGACGTAGCGGTGAGGGTTCGCCGGCGTGGGCTCGA
CGATGTTCTGCACGACTGCGCCGTCCAGGAAGTCCGAGGACAACATGGACATCATCCGTTTGAATGACGCCGTAGTGGGCGTGATGAGCGAGGCCGCGAC
GTCCTCAATATCGCAGGCGAACTTGCACACCGCGTGCACGTTGCAGGGCACATTTGTCGAGGCGTTGGTCGCATCAGCACGGAAGAGCGAGACGCCGTGC
TTTTCGTGGACCAGCGACCACGGAATTCCACCGAGCAGGTCGGTGGCTTCCAGAAGACTCTCGGTCATGCGCTTGGCCACTGTAGTGAGacgctcgcgct
ccttgACGCACATCTCGGAGGTGTCCTCGGCGTCGCTATCGTCGGTGTGGTCTGATCCGTGCGAGGACCCGAAGCTCGAGAGCGAGCGAGGGGTCAAGGG
GGCCCCAGCCAAGAGCGTCGGGCTGTAGTCTGTCATTGCGTTTGTATTTGATCGAGCACTGCTTAATTGGCTACTGCAGGGGCTTACAGTGAGGCGGCGC
AGCGCATGAAGCGGTGGATTTCTCGGGCTTCGGATCTCTCGGAAGCGACGTTCGCGTCGAGACTCCAATGCGAAACTGAGGCCGGTCGAGGAACGCGTCG
CGCGTAACGGCTTCGAGTCAGCACCCTAATTAGCGGCCCAGGAACGGCTAGTGAAGCAGTTGTGTTCTATTTTGTCGCTGACGTGCCTCGAGGCCGGAGC
AGCATCCACACGACACCTTGACACGATGAGTGGGCACTCATTTGCGCCCACGCACCTCGACAGCccatggcgacgatggcCGAGAGCGTGTTTCGAACGC
AGTCAAGCTGGACGCACGGTCAAGTCAA