Description :
From Genome Similarity Track
Location :
Scaffold_278:13640- 14851
Sequence
1211 bases(100 bases per row)
ACCAAAATATTACTCGACGGCTCTCGCGGATGCGACAGTGATCTTGTCTTCCAAGTTAACTACCCAGCCTCTACGCCTTCCTCAACTCACCCAGAGGCTC
GTGGTTATGAGGCACTTTGTGTAGGAGCGCGGCGCTCTTGGACCATCGAAACGAGTGGCTCCTGCTGCTGCTTCGGCATGGACCTAAAAAGCTGGAGAGC
TCTTGGATTTCGGGGGCGTGCTCTTTATGTGTGAGTGTACAACCTAATACAATCCTGGATTTGTTTCTACAATACCAAGTAGTCTGTTGTAACTCATGCT
AGTAGCATTAGGCAAAGTACACGGTGCTATTTGTAGTTCTTGATCATTCATTGCCTTGGAGCCAGCCCTCAACGAATATGCATCTCATCAGCAGTAGGTT
CTGCTCTATATGTAGGATTAACTGCCTTGCGTTCAGGTTGGCAAGGCAACAATGCCGATGGGAATGGCTCATAGAAGTGTGTAAGCGAATGAAGAGCTCC
GTTGGATCTTTTCGTATGGAGAGATCCGTTTCCTGTGGGGCGTGGCGTGAAGAAGAGCGAGTTGCTTGATGAACAGAACCAGACCATTCGTTCATTCCCA
AGAGCTCCATGCAAAAAAGGAGTCGGAGCAAAGCGCCAAGTTCGTTGACACCGACAAGTGAAGGGGTAGGGTTGAAACCACAAAAAAGCATCCTAATCAG
CTATGCTAAATAACATTATGCACTGAGACGATATTTCGACGTCATAATGGACTCAAATAAGCTTGACCATCTCGCAATCAAAAGCCGAAATGTCATGCAC
AAGAAAATTATGCACTATGAGATAATGCGGCACCAATTTTTTGGCTCTGTCAGTGTACAGTCCACCCCCGTTCAAACAGTTAGCACTTGACGTTTTTAGT
GATACTGTGCGTGATGCGCTCTCTGTGACTCACTCGTGGGCCAAAGCTAAAGCCGGTTAGCTAACAGCCATCAGCGCCATCAAACGGACCTCTTCGCCTC
TCGCAAGCAGCATCCTCCTCTCTCGTCCGTGCTGTGTGTGTGAGCAATGAGCACTCGCCAGCAGCAGCAGACGCCGCCACAACGCAATTAGTAGCGCAGG
CTGAACACCAAGCGCCGCTCCAAATTAATACCGCAGGGTATTATTAGCTCCACCACTGGACTCCGACTCCAGTGGATCGCGTCCGCCCAGACCACGACCG
CTGGTCATCTC