Description :
From Genome Similarity Track
Location :
Scaffold_374:13637- 14657
Transcript NameFunction/comments
g17015.t1XP_009527712.1 hypothetical protein PHYSODRAFT_501310 [Phytophthora sojae
g17016.t1hypothetical protein

Sequence
1020 bases(100 bases per row)
TACGGCTTCAGTCGCCCAACGTAAAACGTTGCGTGCAGGCGCATGATGGACGGTATGTCCAGTGTGCACGCGTTGCCATGCTTCGCCAACACGGTGAATG
ACCCAATGAAGCGTGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAAGTTCTGAGTAGCTAGCAAGACTAATGAACCCACTTTGAA
TTAATTTGTGTTTCCTCTGCCAGTGTTGTCGGCGTTCGGCTTCTGTCGACCGACAGAAGCTGCTACCGCGTCCTGGACAAACCGAATTACGGCTTGTCGA
CGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTCCGTTGTGGTTTA
AAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCCCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTG
CTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCA
CGTAGAACGGTGTGTGTCTTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCATA
GCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATTGACAACTGCGTCCCAAGAAGT
GTAAACACTTCTTGCCAGAATCGCGCTGTGAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATGCCATGGTGTCTAAACACCATGTCGACAAACA
GACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACTATACCAGTCTTCCGCTT
GTTGTCTTGCGGAAGACCAA