Description :
From Genome Similarity Track
Location :
Scaffold_49:136357- 144212
Sequence
7855 bases(100 bases per row)
CTACCTATAAATATACGCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTT
GTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCACCGCGGTAGACTAC
CTGAACCTCTCCGAAGTTCGTTGCCATGGACAGGAACGACTTTTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGA
ATGGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGGCCGAGCAGCTCGAGCGCGTCAATGCGTTCGACGCGTACGAGCAGGGTCTCATCGCGCATGTGC
GGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACCT
TCACTTCTGGGTCCGAGAAGTAGAGCCCGCGATGGACGCGGCTCTGATCTGGACCGAGCAACTTCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGCCGT
GCTAAGAGTTGGGTGTACACACGGGAAGCAGCGTCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGTGAACAGCTCCGAGCCGCGTTCCTCCTGGCGA
ACTACGAGTACCGCCAGCGTTCGCACTTCCTCTAGTGTAAAAAAGGGAGGCGTGAACTGCACGAGTACGTGCAAGAGATACGGGAGCTCACGGCGTCTCT
AGTGGGAAACCCACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGC
ACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAATAAGGGTACAGCCATCACCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTTCCTCGTCGGCTC
CCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCTGACATCCGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCAAG
CGCGACTGTCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCCGATGCCAGGATCTCGGGGACAGGGGAACGCCG
GGAGCCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTT
CGCACTCTCGAATCGGCAAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATCGATTCTGGGG
CGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAATAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGAACGGTGTCAGTGCG
ACTGGCCGACGGGAAGGTCGTCACTGTTCCCAACGTCCAAGTGGATCTAGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGGTCACTGTTCTCGAT
ATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGTAATTGGTGCCAGCCGCCCTGCGC
AGTCCGACAGAGCATTGGTGAGTCATGCTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGTTGCCAGGGTACCAAAGCATCCGACGGATGCTTGGG
AGTCGTCGACGTATATGACGACTCCGAGGATGTTTTGATGGTGGCAGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAAC
TTAGTTCCGCAGACAGCTGCAGCTGCCACGAACACTGAGAACAGCGTGTTCGGAGTGGGTAACAGAGTTCCACTCACGGTCACCCAGACCTTAACTGAAG
AGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACAAAGTGCCACGCGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTCGAACACGCTTCCTGTGT
AGGTACCATAGTACCACACGAGGCCACGAATGCCTCGGATGTCGTAGCGCCGACATCCCTAGAGTGTGGGCAGCAAAGATCGACGTCACGGTCGCCGTCA
TCAACGACGCCGCCGCCGCCTCAAGTCGGATCCGCACCCCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGACCGGGCTCCTCCGACAAGG
CCGGTGGAAGAGTGTCATCACATCTTCGATGGAGAGACCGGTTTACCCGTCGAGACATCTGGTGTCCACTTGGAACCATTGCCAGAGGTCGCAGAGATAC
TGAACCTCGAGGAAATGACAGTCGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATTGCTGAGATGGTGCTCATGAGACCTGAGACCACTCGGGAGGA
ACTGAACTCCTCCTCTGGCTTGGACGAAAACGTCCTGGAAGACCTAAACAAGCCGCGTCAGACGCGCTTGGGTTCTGAGATCCTTTAGAACCCCAAGGAT
CCGGTGTACCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCATGAGATTGATCTCG
TGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCTCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCAT
GGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAAC
GCAACGGTGCCGGCCCAAACACCAATCCCATGAAAGGATGTGTTGTTAAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGAT
ACTACCAAATCCTAATGCGGGAGAGTGACATCCCGCTCACCGCAATAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTC
TAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAGCTGTTCCGCCCATCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAG
ACAAGACAGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGCCGTAATACGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGC
GTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGCCAAGGCCATAGCAGTATGGCCGACGCCCCGA
TCCCAAAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCATAAGTACAGCGCAGGGTACGCGGGCTTTGCTAAGCCCTTGTCGGGCCTTTTTC
AGAAGGACGTCGACTGGCACTAGGACCAAGAGCACCAGGATGGTTTTGACAGCATCAAGGCCAGTATCCATGAGGCCCCTGTCCTGGCCCTGCCGGACGA
GACGAAGCCGTTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAAGCCGACACGGCTGGACATGAACGAGTCATCTCGTT
CCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCGACGACAAGGAGCTCCTGGAAACGAAATATGCCCTAGTGAAGTTTCGTGTTCACCTC
CTGGGCCCGAGGCCCTTCGTGATCTACACTGACCACGCGTCTTTGAGGACGGCGACTAACTCGCCTAACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCT
TCTTCGCGGAGTACAGCTTCCGCGTCGAGTACAAGCCGAGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCTGACTATGAGTTGGCCCACAT
CACACGGGTGACAACGGATCTATATGATCGGATACGCATGGTGTATCGGGACGATGAGGCTGTCGCGCCTATCGTGAAGTTCCTCATGGCAGGAACGAGC
GCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGATGACCTCCTCTATTACCGGGTGGAGCCCAATGAACCTC
CACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGATATCTTCGCGGAGGCGCATGACGCGCCCTCCAGCGACCACTTGGGCCGCGAGAATACCTT
TCTGTCGGTCTCTCAGGTCTTCTGGTGGGCCCCCATGTACAAGTGGGTCGCCCAATACGTTAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGG
CACGCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCA
GCACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCGGTTCCCGTTACTGTTACGGGCGAACAAACCCCAAGGTTGTTCGT
TGATGGCGTGTTTCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACGGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTG
GGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAGACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCG
CGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGCTCACGCCGTTCTACTTGAA
CGGCTTCCGTCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTC
TCGGATGTGAGACCAGTTTCGCTGCGGAAACAAGTGGAATCCTGTATAGATACCAAGCTGAGCGTTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCC
AAGATAAACTCCGACAAACATGGAAGAGGAAACTTAAGTGTATTTAAAGTGGGGGACTTAGTGTTACTAGACACAAGGAACCTACACCTTGACACTGTCA
GCGCTGTCGTCAGCAACAAGCTGAAGCACCGCTTCATCGGACCATTCACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGA
GGCGGTCAACCGCAGGGCCCTGTGTCGGAACCGCAGCCGGAGCGCTCGGACGAAAGTGTCGCTCGGGAGGTGCCGAGTACTCGTACTCGTACGAGGGCAC
CTCCGCCCCTGCTTGACCGGAATGGAGAAGTTCACATCCACGTGGAGCGGATCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAATG
AAGGGGTTATGCCCACTCCGAGATCTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGAGAACAGAAGCGGCGGCAG
CTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGACGGACGTTGAATACACTCCGTACCCGCGCTCATCATGAGCGCTGGAAGCCGCGTGCTCCAGG
ATGTCCCTTGGCAGCATGCGCTTGCTGACCAAGTGGGCAAACCTAACACGAAGATCACGCTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGAGTT
CCCGTAACTCCGTGGGTGAGTGCTTAAGAGACTCCACCCATGCCCAGAACATGTCCTCACAAGAACTCCAAGTGGGACAGTTCTCGCGCATATGAGATCT
CGTGGGAGCCGATTGAACGGCTCCTGATCGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTG
CCCGAACGGGGTATGGACGTTGAATACACTCCGTACCCGCGCTCATCATGAGCGCTGGAAGCCGCGTGCTTCAGGATGTCCCTTGGCAGCATGCGCTTGC
TGACCAAGTAGGCAAACCTAACACGAAGATCACGCTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTGCTT
AAGAGACTCCACCCATGCCCAGAACATGTCCTCACAAGAACTCCAAGTGGGACAGTTCTCGGGCATAGCCCAGGGGTATCCCCAAAGAGGATAGATACCA
CCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGGATGCGGCGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCAACGA
ACAACTGTTGCTTCTGAACAAGGGCACGTTCGTAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTC
AGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCTCTGGCTGACGGGTGCCACCACCGAACCCCCACGCACACGCTGAGCA
GCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTTGTGACCTCCCGGGGCTCAGCGATAGCACCCTCCTCCTCTTCTTCCTCCTTCTCCTCCTCTTCAT
CCGAGGAGTCGAAGATGCCCCGATGGGAGTGTTGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTGGCGCCTTC
GGCTTTAGAGGCCTTAGCACGCACAAGACCCTCGGCAAGGGAGAGACGTTTGCGAGGATTCTCCTCCTCATCGCTAGCAGCTTTGGGAGTGCCCTTAGCC
TTGACGGTCGGGCTCTCAGAGCGCACAGACGTCCTGGGACTGTGATCACCTTGATCACTAGCGAGCGACTGCACGCTGTCGTCCTTGTGCTCGCTGGGCA
CTGGTCTGTGCCCTCCCGCAGAGCCCACAGGAGCATCGTGCGTGCTCTCGGACTCGGCTTCGTCCTCACTGCCAGAGTCGAACTCACGTTCAGCGAACCG
AGGATTCGGACGGTTGACTGGAGAGGCCGAGGGCGACGGGCTGCGGCGCTTGCTTGCTTGCCCACAGCCGCGTCATTCGAGGTACCGATCGCCTCGGAGG
CCACCTGAGTAGCCTCCTTAAGTGCCGAGCCTTTGCCGTGAGGCTTAGTGCTCTCGGCTTGCGCCTAACCGGCAGCAGCCTTGGAGCGCGTATTAGCACC
GCTCTTTGCTGTACCACGAGTCATGGTAAACGGTCGAAGTGGAGACCTAGAAGAAGAGCGCACATACTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCT
CCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACACCTTTTCATTCTGATTGGTAGGTAAACCGAACCTAA
GTGGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGACACGTCACACTTCAGAAGTATAACACGTCAGACTTCGGGA
TATTTGGTACAACGTACCAAGGTCGTTCAAAGCCAGCCTGGTTAAAGACATTGCATTTCTATAGGTGACTTATAGTTTGTATTAAGCCCAAGCTTTATCT
ACCTATAAATATACTCAGTTTACATTCTACCTTAATTAGGTCACTTCGCTCTTTTTTGAATAAAGAGGGGACCTGTGAGCTGCCGTTCACTGAGAGTTTG
TATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACA