Description :
From Genome Similarity Track
Location :
Scaffold_9:136346- 137524
Transcript NameFunction/comments
Phyke_g874myosin-like protein

Sequence
1178 bases(100 bases per row)
AACCCACTTCTGGAAGCTTTCGGCAATGCCAAAACTATCCGCAATGACAACAGTAGTCGTTTTGGCAAATTTATTAAGATTTTCTACTACGCGGACGGTA
CGATTTCGGGTGCTACGACGAGTCACTTCCTGTTGGAGAAGAGCCGAATCGTGGGCAGTGCCGAATCTGAGCGCAATTATCACATTTTTTACCAACTATG
TGCGGGATTACCTGCTGAAGAGAAGGCGGCGCTGAAGCTTAAGCCTGCGAGCGAGTTCTGCTTCCTCAATCAGGGCAACTGCATTCAAGTACCGGAAATT
AatgacaagaaggacttCAAGGAACTCGTGGAAGCTATGGGAACTGTGGGTATCGAGCCAGAGTTGCAGAAAACCATCTTCTGTCTTGTCGCCTGCGTCT
TGCATTTGGGAAATGTGGAGTTTACGGAGAATGCTAAGAATGAGTCGCAGATTGCTCACCCGGAGGATATCACGAACCTGGCCGAACTGATGATGGTTAC
ACCTGATGAGCTCGAATTTGCCCTAACAAAACGTACTATGTCTGCCGGCGCGCGTGGATCGGTGGCAGAGATCGCACTGACCGCTGTAGAATCGGTGAAG
TCGCGAAACGGCCTGGCAAAAGATATCTTCAGCAAAATCTTCGACTGGCTAGTTTTTCAAATCAACAAGTCAACGTCGCAGGTTGGTGGTGCCTCTGGTG
TAGGAGCGGGAACCAAATTTATTGGCATTCTGGATATCTTTGGCTTTGAAAGCTTGCAAGTGAACTCGTTCGAACAGCTGTGCATCAACTATACGaacga
gatgctgcagcagcaattcaACCAGCACGTGTTCGTGTATGAACAGGAAGTGTACGTGGAAGAAGGTATCGATTTTTCGCGGCTGGAATTCACAGACAAC
GGGCCATGCCTGGACCTCATTGACAAGAAACCACTTGGTATTCTACCGCTGTTGGATGAACAAGGTATGCTTGGTCGGCGTGCCAGTGACGAGAACTTCA
TTCAAAAACTACATCAGACGCATGTACCGAAGGGAAAAGTTCCCGAGGGTACGATCATCTACTACTCTAAGCCGCGTTTTGCCACGGACGAGTTTGTGAT
TCACCATTACGCTGGTGAAGTCACATACAATGTCAATGGTTTCTTGGAAAAGAACGATGATTCACTGCACAATGATCT