Description :
From Genome Similarity Track
Location :
contig_19:136338- 138799
Sequence
2461 bases(100 bases per row)
TATCGAGTGAACCATGGCTTGCCGAGAATAACGTCAGGGAGATCATACTCAGTAAACGTTCCGCTGTAGACGTTTTCATCCATGATCATAGGAGCACTTA
CTTCCCGTAATTTAACGTCGTGGCGGACTTGACCATCAAAGCTTTCGACTGACCCAACATGCTCAACACCCTGCCTGGTGATGATACCTGGACGGATCAG
ATTATGGTTGGCACCACAATCGATCAGAGCGATCAGTGAATGACCGTCGATGGCAACTTCCTTTCGAATCAGATCGTGGTTCTTGTCAACGTCCACCGAC
CGATCACTTTTGCCATATTAAGGCTATAACTCCGAAAGGATAGCGGTTCATCCGCTTCCGACCTCGTCACGGCTTGCTCATGCACGTTTACAGCATTAAT
GGACCTGGTGATTGATTTGCCGTATCGACCACCTTTCACGTACGGTAGCTTTACGCGACAATCGTTGATTCGGTGCCCAGGTTTCTTGCAGCGAAAGCAC
AAATTTTTTGCGGCACTCCTCTCTTGACGTGTTTCGGACATTGACGTTATCGACTTCCATCGGAACAGCAGTGTCTGCCATTCTTTAGTCACGTCTTGGT
CGATGGGTGCTGCGGTCTCCTCGTGCATGCGGGTGTGCACGCTCAAATTCAAGTGCAACAGTAATTGCCTTTGAAACTTTCGAGCATCGGCGATACGCGA
CTTCTTCACGAGTCCTGGTCACAAGTCCGTGAACGAACCAAGTAATTTGGTCGATGTCACTCATATCCCTCACATGACATATTACTTGCCGGAACTTTGA
CACGTAGTCCTCCAAATTATCGCACTGAATCTGCTTTAGTTGAAAAAGCTCCGCGCGCAGACGTTCTTGCAAGTCTGGTGGTACAAATTCAGCCTGGAGT
GCCTCAGCCAACGCGTTCAGCGACACAAACTTCCCTTGGTGGAAAGTGTACCAAGCTGCTGCTTGACCCTTCAAATTCGTCGCAACCATTGCTACCAGTC
GGGCTTGGTTCTCTGCAGCATTTACATCAATGTTTTTTGCACTGAAATAAAGCTGCACTTGCTGTAGGAAAACTTGTAGCGATTCTCCAATTTTCCCGAA
GTACGTTGGCATAGAGATGCCTTCAACTCGTCTTTCAGTTGATGCACTCGGTTTTATCTTGTCCAGCATTTGTTGCTGCTGCTGCAACAGCTGCCGCATC
TCGTGCTGCTGTTGAGCCATGACCTCTGCCATCCTGGCGAGCGTCGTCATCGCAGTTTCTTGCGTCATGGTGCTACCTGCACCCAAGGCTGCGCCTTCAT
CCATGGTTTCCTCGTTGATCTGGTTACTGACGCCCAGTCCCAAAAAAGCACGTACAGCAGGCTAGTGTGGCCACCACTGCCGCTAGTGCACTTGTCACGT
TCCGAAGAACCGTCTCCCCCGCACTGACCAACAAGTGCTACCAATTGTCGACTTTCCGAAATCGACGGAGGGTCTTGTTTGTGAGGTGTCGGAACTTGCT
TGTGGATGACGGTTCTGGAGGTTGTAGTTGTTGTAGTTGATGCGCGGTGTTGAGGGCAAAATGCAGAATGGTTATATTTTTTGTTTTGTTCTCGTGCCCT
GTTGTTTCTTGCTTTCTTAGGGCCCCGCTCTAGGAACGACACCTTTCAATACATACACGAAGTCTTGGTTGTCTTCTTCAACCTCTTGATTATGGTCGTG
GTGATGCTCGCCGTTGGCTTGAACGCTGGGTTCGCGTGGGTTGCAGATTTGCAACATGAAGCGCTTTGCTGGCAACCTGATAGTCTGTTGCACGAGCATG
GGCTGCGAAAGCTTTCCTGTTGACGCCACCACCATCAACGAGTGTGTCATGGGTTGTTGCCGGTGCGACTCGACTTGATTGTCCGCGAGTCCGAGCGCTA
GCGTGGCTTGCGTTGCGCGCAGCCAAAGGCTGACAATCTCCCCTAGAAGAATTGCTCTTACTGCGTTGCTGCTCCCGCAGCCCCTTCAGTAATTGATGCC
AATGAACGACATGTTTGATGTCCTTCTCTAATTCCCATGTACACTCTGACATCGGCTCACCAAGCCACTTGACGAGATACTCTGGCTTTCGGTTAAACTG
CCTTTTGGCAATGAGCCGCTCCACAATACGCATACCGTCGTCGACAAGTTCATCGGGCAGTTCTACTGGGGTGTCCTTGAATTTTGGGCGCGAGCGGAAC
CGTTTGAACTGCTCTGGGTACGGCGAAAGGAGGTCGACATTGAAGGAAGGATGAATGCGTCGAAATCGCTTTGGTAATTTGAGCCTAGCCACGTTTTCAT
TCACCATGTACTCGATGGCAAAAGGTCCCACCAATCGTGCTGCCAACTTTGCTTTAGTTAGCTCCGTGTTCTGAGAAACATGCTTGAACGATAGATGCTC
GGTTTTCAGCAGTACCTGATCACCAGCTTTGAAGTCTGGTTCCGACCGACGCTTGTCGTAA