Description :
From Genome Similarity Track
Location :
contig_7:136337- 137793
Transcript NameFunction/comments
g2338.t1hypothetical protein
g2339.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
1456 bases(100 bases per row)
AGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCGTGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGACTGGTCCAATGA
AGCGCGGAGCAAGCAAGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTAAATTAATTTGT
GTTTCCCCTGCCGGTGTTATCGGCGTTCAATAGCAGCTTCTGTTGATCGACAGAAGCTGCTATTGCGTCCTGGACAAACCGAATTACGGCTTGTCGGCGC
TGGACAAAGTTCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTAAAG
TGTCTACGCCCGTCGTAGACACTGTGTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATGGCTTGTATCAGCGTGCTT
ATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACG
TAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGC
TCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGT
AAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCAGGTCAACAAATAGG
CATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTG
TTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAG
GCTTCACGCGCTGGCATACCTCGCAAGCACGACCGTACTTGCGTACCCATTTGTACTGGTGACTTCAGTAGAAGTCACGCGTGAGAAGCAAATATGTCTT
CTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTG
TCGTCAACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCATGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAG
GTGTGGAGAAGTACTCCAACAATTGCTTCGCATCCGCATCATGTGCGTATGCGGCC