Description :
From Genome Similarity Track
Location :
Scaffold_21:136329- 140311
Sequence
3982 bases(100 bases per row)
CAGTTTATAACTTACCATAAACTGGTTACTTCATTCCTTTCGACAAAAGGGACCTGTGAACTACAGCACACTGAGCGTTTGTATACTCTTGGAAGCCAAC
TTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTAGTAGCACTCGTAGTCAATCCACGCCAACGCGGGTAGACTACCTGAACCTTTCTGAAGTTC
GTGGATAGAAACGACGTCTCCCACCTGAACGACTCACAGTTCGAGTCGGCTTGGAAGATGGCTGGCATCTTCGGGATCGAGACCCTGTAGAACCTGGTGG
CGTCAGAACCGGCCGAGCATCTCGAGCGCATCTTTGCGTTTGACGCCTACGAGCGAGGGCTCACCGCCCGCCATGTCCATCACACCTGAAGCCAATACGG
CTGAACGTGAATCTGCACGAAGGAAAGATAGATGAGAACCTTCACTTGTGAGAGGTAGAGCTCGCGATGGACGCGGTTCTGCTCACGACCGAGCAACTAC
GCGTCGCTTTTGCAATCCCCAACCTTAGTGGTCGTGCCAAGGGTTAGGATTATACGTGGAATACGGCATCGCCTGTATGAGTCACATCCTGGGATCAACT
ATGCGAGCAACTTCGAGCGGCGTTCCTCCCGGCGAGCTACGAGTACCGGCAGCGCTCGCGCTTCGTCTCATGCAAGCAAGGAAGGCGCGACCGGCATGAG
TATATCCAAGAGATGTGGAAGCTCACGGTATTCCTAGCGGACAACCCACTCAACGAACACTTCAAGGTGACAGTGTTCATCGACGGCCTTCAAGTCCGAC
CGGCGCGCACTCCGCTGTGCCGGGTGCAGACAAGAGCCCTCGGAGAGGCGATCCAAGTGGCTCATCAAGAAGAATTTAGCCATCACCAGGCGCGAACGTC
GGCCTCAGCGTGACCAGGGAATTCTGTGTCGAATACCGGTCGAGCCATCCCCACCGGACCAGTCTCTATCGAGCTCGGGTCCGCCGAACAGTGCGACATT
AGCTGCTTCGGCTGCGGGAATCTGGACCACTGCAAGCGTGACTGCCCCGCGGAGAGACACCGCAGGCACTTTCCTAAGCCCATCCGCAGGGGTCGCTGGC
AGAAGCCAGGATCCCGGGTCAGGGGAACGCGGGAGACCATTGGGGCGGGACGTCATACAGAGAAATAATTAAGTCTTCGGGAGAGGTACGCGGGTGGCTC
GTACCACGGTGACTTAGTCCCTGAGAGTCTTTGCACTCTAGAATCGGCAAAGACCAGCGGCGGGCTGCTTCTAGTACTTGAATGGGTACGGTAATACGAC
CGCTGCCTTAGAATCGCAATCGGTTCTGGGTCGTCGAAGAGCTTCGCACGCCGCCAGACGGCTGCTCGTAACAGCAACAAGTTTTCCGATGCTTTGAGAG
AAAGCAAATCCAACGGGACAATGCCAGTGTAACTGGCCGACAGAAAGGTGGTCACTGTCCCCAACATCCAGATGGGCCTGGCAGTCAAGTTTGAAGACTT
CGACAGCCCCGAACAGTTTACTGTTCTCGATATGGATCCCTACGATTTGAACCTGGGCATGCCCATGCTCGAGGAACACAAACCTGACTCGGCTGGCAAG
GCAAGACAATTGGTGCCAACCGCCCTGCGTTTTTTGAAAGAGCTTTGGTGAGCCATGTTCCCAACTCTGTCAGGACCCGCAAGGGCGGCACAGGTACCAA
AGCATCCAACGAATGCTTGAGAGTCGTCGACATATAATATGACTCCGAGGAAGCCGTCAAAGCTAGGTGGCGCTGGCCAAGTGGGTAAGGTAAGTCCACA
AGCGGGTAACATAATTCCGCAGATAGCTGCAGCTGTCACGAATACTGGAAATAGCGTGTTCAAACTGGGGCAACATCGCTCTACACACGGTCGCCCAGAC
CTTAACTGAAGAGGACAACGCTGGATACGCTTACTCTGTGGGTAGCACAGTGCCACACGAAGGTCGCTCAGATCACAACTGAAGGGGAAGACGCGGGATG
CGCTTCCTGTGTGGGTTTCAAAGTACCACACGAGGCCTCCGGTGTCTCGGATGTCGGCGCTACGACATCCCCAGACGTGGATAACGAAGTTTCACATAAC
GGTCGCCGTCGACGACGACGCCACCGCAGAGAGTCGGATCTGAACCTCGTTCAGATCGACGTCGTTGCAAGCGACTCGGAGTCCAGGACCCGGGCTCCTC
CGACACGACCGGTGAAAGCGTGCTATCACATCTTCGATGGCAAGACCAGGTTACCCATCAAGGCATCTGGTGTCCACTTGGAACCGTTGTCAGAGGTTGC
AGATATACTGAACCTCGAGGAAATTACGGCCGAGTCTTTCCGGGCCCACTTCAAGGTTGAGGAGGTTGCCGAGATGGAGCTCATAAGACCAGAGACCGCT
TGGGAAGACTTGAGCTCCTCATTAGTCTTAACGAAGACGACCTAGAGGAGTGGAGCAAGCAACGTCAAGCGCACTTAGGCTCTTAAATCCTTAAGAACCC
CGAAGACCCGGTGTATCTTTTGGCGACGGGGTACGCGGACGTGGTGAACTAGCACCCACGGACCCAACTACCACCGGACAGAAACAGCATGAGATCAATC
TCGTGTCTGGCACAAAGAACTGTGTCACGGGACGATGGCCCCGCCACACAAGCTGTGCGAGGTCATTGATGCCTTCTTCGCTGCGAAAGCATGAGATCAA
TCTCGTGTCTGGCACAAAGAACTGTGTCACGGGACGATGGCCCCGCCACACAAGCTGTGCGAGGTCATTGATGCCTTCTTCGCTGCGAAAGTGAAGGCAG
GCATGGAGCGGGAGTCAAAGGCCCCGCACTCGACTCCAACTTACTGCGCTCGGAAATCGAACAGAAAGTGGCGTCTGGTTCATACTTATAACAAAGGGAA
CAACGCGACGGTGCCGGATCAGCCAACAATCCTACGAAAGGATGTGTTGCTGAACAACACGGCCGAATACGTACTGTACAGTACGCCGGATTTAGGAGAC
GGATACTACCAGAATATGATGCGCGAGAACGACATTCCGCTCACGTGGTAAGCACTACAAACGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGACCT
GTCTAACGCCGCGGAGACAATCAACGGCCTGGTGACGCAGCTGTTCAGGCTAGTGCGTGCCTCGTACACACGCACTTCGACGACATCTTCGTCCATATCC
GTACCGAGAGAGACAAAACGGCCATGGAGGTGCATTTGGGGCACCTCCGTCGAGTGTTGGATGTGATGAGAGCGAACAAGCTCTAGGCCAACATCGACAA
GTGCGGCTTCGCGTCGCCAAAGCTCAAGGTTCTCGGTTGCTTCGTCAACAACGTCGGCGTTTGCGCTGACCCAGACAAGGCCAAGGCCATTGTAGCATGA
CTGGCGCCCCGATACCAGAAGGATCTCCGAAAGTGATTGGGCTTGACCAACTGCCTTCACAAGTACATCGCAAGGTACACGGGCCTCGCTACTCCCCTGT
CGGGCCTCCATCAGAAGGACGCCGACTGACGCTGGGACCGAGAGCACAAGGATACCTTTGACAGCGTCGAGACCAGTCTCCAAGAGACTCCTCAGAAGAT
GTACCCGAAACTTCACGAGGGCATATATCATTGCCAGGAGCTCCTTGTCGTGAGCAGGGTAGTTCCGCTCGGCGGCTTTGAGCTGCCTGGACTGGAACGC
GATGACTCGCTCGTATCCAGCTGCATCGGCCTGCAGCAATGCCCTACAGATTGCCTAGTCGGAGGCATTGCAGACGATGCTGAACAGCTTCGTCTCGTCC
GGCAGGGCTAGGACACTTTGGGATCTACACAGACCACGCATCCTAGCGAACGGCGACGAAGGCGTCTCACCTCTCCCAATAGATGCTGAGGTGGATGTCC
TTCTTTGCGGCCGCGTTGCGTAGAAGACGAGCAAACTTAACGTGCTTGCGGACGCCTTATGTCGGCGTCCGGACAACGCGTT