Description :
From Genome Similarity Track
Location :
Scaffold_178:13632- 15866
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_178-snap-gene-0.28Conserved gene of unknown function

Sequence
2234 bases(100 bases per row)
CCGACCGATGACAGCTTCCTCGCCATACAGGCGCAGGAGAACCTCGCGAGAGCGAAGATGGTGATCGCCGCGTCCGCCAACGCAAGCGCGACAACCAACG
CGACGATGACGTCCGACTTGTTCACGAGCCTTCATGATGTGGATCCAGACACGCTCATGGCAATCGGTGCGGTCGTTGCCGTGGTCCTCTTCTGGCTCAT
GCTCTGCGGGATGTGCCGTTGCGTCGTCTGCGTGCCCTGTCCGTGCTGCTTCTGCTACATTCCGTGCTGCTGCGGCTTCTGCCTGAAGGAAGACAAGGAG
AAAGAGAGATTACCTCGCGATTATCACTACCACCAACACGAGGTGCGCCACTATCAAGATATCGCAAAGATGAAGAATGGAACAGTAGCATATCGTCAGA
ATACTGCAGAGATGCCAGCGTACTCATCATTCACCGTGGACATCGAGGAGCCGCTGCTGGGACCACCAGCGTACTCGCAGCCGCCCGCGTACGAAGCGTC
TCCACCACCGTACCACAACGTGCCCACTGCACCACCACTCAGCTAGAGAGCAGTCACAAACCAGTAAGTACCTCTTACTAACTACATTCACAGCATTTAC
ATCACAGAAGACTGGGCGTGCGTTTAATGAAGAAAGCCGTGCCCCTCCATGCAATCCAGAGTGTTGATACCCATTCTCTAAAACCGAAAGAAAATAAATT
ATACATCGTTCTCTCCACCACATAACAACGCAATGCACCTGTCTTCGCCGCCTGTTCTTGCTTTCGGCACACAGAGTCCTCCATTACGGTTGTCTAACTA
CGCGCCATCGTTTTGTTGTACGTAGTGTTCTGTTTACGAGAACTTCTCGCTCTGTTCGAGCGCGCTCTTGAACGTCACATCCTCAACATCACCATCCGTT
TTGTGCTCTTCCTCTTCGTCCTCGTAGTCAAGCAGCGTCTTGAGCAGCACCGCCTCTTTCTCTTCTTCCTGGAGCGATTGGCGTCGCTGAGTCTCCTTTT
TGTGCATCGCGAGCAGCTCCGCGAGCAGCTGGTAGAGCAGATCCACCTCCAAGCCTGTGGCGATCGTCAACCCTCCGCCGGCTTTTGTGTGACCTGCGGC
AGATTTGAGCTCAACAACGACCACGCGAATGCCGTACGAGGTCGTGAGGGATACGTTCATAATGTCCTCGAACGGCAGCACGGTCGTCGTAGCGAAGAGC
GGCACCATCGTGCGGTAGATGAGCGACCCGTAGGTGACATGGAGTTTCGATGGGATCGAGTTGATCACGCCCGCGCCTTCGTACAAAAGGACATCATTCC
TCTTGGCTTCAGGTGTGGACGCTGCTTTCAGTGACGTGACTTCAGCACCGGCACTATCATCATGCAAACCGCACAAACGTTAGCAGCTAGCTTCACAAAC
GAGGACCAGCAATATGTAGAGAGCCCTCGCGTTGTGGCTTTGTATGAAGGGTACGTACTGGTCCATGATCGCCGTGATCGCGCGCACACGCAGCCGCTGC
GCGGCATCTGCGCGTGCCGTGACCTGCTTTTGCTTCTCGTCGATCTTGGTTTTCACTTTTCGACCGCCCTCAGCAGTCAGTTCGCTCCAGAGCGCGTGCA
CCATCTCATTGATTACTTCACCATAGCACTTGTTGGGTTTCTTCATGCCAGTAGGTCTATCAGCATTCACATCATCCGTAGCTGACGGCACTGGGGCTTT
CTCTTCGTCATTTAAAGTGGATGAGAGAGAGGCTGACGCAAGCGCATTGGCGAGACTTGAGGCGCCTCCTCCAGTGGGCGCTGACGAAGGAGCCTCTTCC
GTGAGTTTGAGGTTGTACTTCTTGAACAGCGGATCGAGGAGTCCGATAAGCAGCGCGCACGCAAACTCCTGCTCGTACGCATACTCCTCCAGCGGGATGC
AGAGATCGCGCATGTTTGTCTTCATTTCGCTACACGTATGCCACATTAATCAGGGACGCTGTTAGCAAAGTGCTACCATGTTGGACGTGGAGATGATAGA
AGTTGTCTTATGGCTCACCTGGAAAACATCCGCTTGACGTCCTGGACGTAGCCTTCGTCCAGCTCTGCGCCTTTCACATCTGCGTACATATCAACATCCA
TAGGGATCTCTTTATTCGACACCATACACATGGTACATCAAGCCCACTCACTATACACAGTCTTTGGTTACCTTCGTCCGTTGTGTTCTCTGGCGTGGAC
ATGAACAAGTGGCTCAGTGACAGGTACTGGCTGA