Description :
From Genome Similarity Track
Location :
Scaffold_93:13630- 17234
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_93-abinit-gene-0.45Mitochondrial protein surfeit 1/SURF1/SHY1
Pytul_var.sporangiiferumsnap_masked-pug3_contig_93-abinit-gene-0.52Gene of unknown function
Pytul_var.sporangiiferumsnap_masked-pug3_contig_93-abinit-gene-0.51Gene of unknown function

Sequence
3604 bases(100 bases per row)
NNNNNNNNGTGGCCCGGTTGCTTGATCTCGTATCGTATCGGAGCTCTTGGGTGAGTGGCCCAAAACAATACCCCAACTGTATGGTGGTAGTCAAAATGGT
GTCTTTGTTGACTACGAGATAGTCATAATAAAACCAAATCGGACTACCCGATAGTCATAATCAAGAGCTCATCAACACTTTTGAAAGCGTCAAGATGCTC
GCACGTCAATGCCGCAAAGCGCAAGCGCTCGGCGCACGTGTGCTGAAGCAGCAACAGCAACAGCTTCGCTGGGCGTCTTCCGCGGGCGCACCCTCCTCCG
AGACTACTACTGCGGCTGCTGCAGCTGCGAACGCGAGACAAGCGAGTGGTGGTGCATCGAAAGAGAGCAATTTCTCTCGCTATGCCGGCATGGCGTTTTT
CTCCACGATTGTAAGTCTGTGTGTGCATGAAGATGTCTGACTGTACATACTTGCTGTATGATGGCATACATATGCGGGCAAATTGAGCTATAACCGTAGT
TTGATTGCTAATGGGCGGTATATGCATTTTCGGTGTGAAGGTTGCAGGAACGGCGTACTTGGGAGTGTGGCAGGTGAGTCTGAGATTTCTTTTGCAAAGG
GCATTTATGAAGCAAAAGTAGACACCGAGATGACGGCAAGGAAAGTGTAACAAAGCGATGTTCTGTATTGCTGCAGACGCAACGGTACTATTGGAAAGTG
GATTTGATTGAAGAGCGCAAGCGCGAGCTCCACGAGACTGTCGTGGACTTACCACAGGATGCAACGGCGCGAAGCAATGTGTACGTGTCTTGTGTTTATT
GCAAAGCTCTCTTCTGGAGAGGGTATGCTAAAAGGAAGTCGTCCATTGCATGTAGGGACGATATCGAGTACCGCCAACTTCGTGTCGAGGGCAAATACAA
GCCTGACAGCACCTACTACTTGTGTAAGTACGCCCATTGACGAAGCGTATGACTGTTTGTGGGTGAAATGTTGACTTGCAAACTCTCTCTATAACGCTGT
AGATCCTCGCTCGGCTCCAGCTGAGTCGACTGATTCGGTTGCGGCTGTCAAGTCTGGCGGATATCTTTACTCGCTCTTGGAGCGAGACAACGGGTACGAA
AATTTTGCTTTGGAGCGGATAGAGTCAATCATTGTAAACGTAACACCTAACATATGCATTGCTTGTGCACAGCACTCCTGTCATTGTGAACCGAGGATGG
TTGCCTCGCAAGTTGCTGGATCAGCACATTGCTAGCAGTCACAAAGAAGGTGACGGCGAGGTGTCCATCGTGGGAGTCCTTCGTCACGGCGAGGAGGTAC
TTTGCAGCTGTCTAATAGTTTTGACCCTATTTCTAGTACTTATGTGGTTTACTCACACATTTGCTCCTCACCGACATTAGAAAGGTAAGTTTACGCCGGA
TAATGACGTGAAGAACCGTCAGTTCTTCTACTTGCAGCACGAGGAGCTCGCACGCGCAATGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCTCCCC
GTCATCGTCGATGCGCTCGCGGTTGAAGGAGACACGGCCGAAGCCTCGTTGACGCATCCATTGCGAAAGCGAATTGCGAACTATACCGAGTTCTACATGT
CGCCCGAGAAGCACGCCGGTTACGCAGCTACTTGGTACAGTTTGGATGCGAGGCTTCCCTACTTTCTCTGAGGCCGCTGACGTTCATGCTGTCTATCTAT
CGTCCTTTTCTCCACAGGTACTCATTCAGCATTGCTGCTGCCGTGATGGCGTATCTGCGCTTCAAGAAGGGCAAAGTGGCCACCATTCCGGGTCAAAAAC
GCAAGTAAAGCCATGAAAAGGGAGAGCACGATGTTGATCTCTACCCTCCCAACCAAAGTCCATGAACATGGTCATCAAAAACAAAATACACCAAAATTAT
CACAAAACTATGCATTCAACCGATCTGGTGTATTTCGTGTGCACTGGCGCATTTTCGCTACAACGCACATGCTCCAATGTTATGTGCACCACACTATTCT
GGCTTTTTTTTTTCAAACTACGTGCTGTTGCCGCCAGCCCGACTGATAGCAAACAAGCCTTCGCAATTTCCCCATATTGGTTCGCCCGCAGACCGCGGCC
ACATTCAACCAGGCAGTCCTATGGTAGCAATGGCGAACGGCGCGCCCGCGTTCCCGTCCCCGTCGTCCGCCTCGGCGGCCACTGNNNNNNNNNNTCGTCC
GACACATCGCTGATGCTGAACACCCAGGCGATGGGTGCGGCTCAGCAACTGCAACTGCAACGGACAGGGGTGTCCCAGATCGCGAGCAACGAATTGACAG
CGCTTCAAGCCAAGCAGCAGCAGCAGCGGCTCGTCCAGGAGCAGCAGCGCATGCGCTTGCAGCAGGCAAATGGTGGTGGTGGTGCTGCTGCGGGAGTGAA
TGGAGGAGCAGGTTCGCAGTTGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGTGGTGTTG
TGGGCATGCTGAAGTAATGGAATTGGTATGTTGTGGTTTGTGTGTGAGTGCAGTTTTTGTCGGCGGAACGCAAGATGACGTCGCGTGAGATCCAGACGAT
GCTTGAGAAGAATGAAGCTGCACTACGCGCATGGAACGCGCTACATACGCAAGAACGTACGCAATCGAATCCATCCCTTGCTTTTGGTCTGTGTGGATGT
AGCTCTTGACGTTACGAATATTATCTTTTTGTGAATATTGCATACCGTACAGCTCCAAAGGCGTTGATGAAAGAACACAAAGAGTGGATCCGCAAGTGCA
CGACGTTGCGGCAGCAGATTGGCGCACGACTCGAAGTGCTCGCCTCGCTCGCAGACAAACAGATCGCGATCGAGGATGAGAACTCAGAGCAAGTGAAGCA
GCAGAAGCAGGAGCCACAGCATCGGCAACAAAATCGTCAGCCAGCGGCGAAAACGACAAAAACGGCCCAGGCAAGACAGGTTGTTACGCAGCAGCCGAAG
CCATCACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGAGAGCGCGACGAACAACGTCCACCTGGCAACGCCTCCCACTTCTG
TCCCATCCCCCACGTCCTTCCCAGATCCACCCATGCCCATGGTCAGCCCAGACAACGCTCAACAGTTTGGTAGGTGCTATCTTCTGCGTGCATTTCGCAC
AGAGTCAAGAGATATGTCGTCTGACGAAACAAATGCGTTATATGGTGAATCTGTAAATCTAGGTTATCCAACCGCCGGANNNNNNNNNNNNCGTGTTCTA
TGGTTCTGGACAGAGTGCTGCCATGACGTCCACCACTGGCTTTGCCAATGCTGCAGTGTCATCGGCCAACACTGCTACTGTCGCCTNNNNNNNNNNNNNN
TCGCAGGGCTTCCCCATGAGTGATGCTCAGTCTTTTGCAGCGAACGCGTACATGAACTCCGCCAACCCTGCGACCAACGCTGCTGCTAATGCAATGTTTA
TGAACCAACAGCAAAACTACATGATGAACCCCGGCGCGATGAATATGGCGATGATGAATCCGCAGTATCTCGCCATGCCGATGCAGATGCAAAGCCAGCT
TCCG