Description :
From Genome Similarity Track
Location :
contig_118:1363- 5784
Transcript NameFunction/comments
g13322.t1XP_009518077.1 hypothetical protein PHYSODRAFT_295452 [Phytophthora sojae

Sequence
4421 bases(100 bases per row)
CGCTTAGGCCCCCAGCGGCTCGGCCTCGACCTCTTCCTCGCTCTTGACGTCGCCCTTGGCCGCGAGCTGGGACGGCTCGTGGTCGTCGCACTGCGCGACC
CACTTGCTCTTGACCGGCATGATGTGGCAGTTGATGCGCATGACCTTCAGCCCCTTCGTGACCTCCAGGTCCACCTGCGTCCAGTTGTTGCGCTGGTCGG
GCATGGTGCAGATGTGGCCCACCTTGGGCTGGCCGCAGCGGCCGCACTTGTACAGCTTCCGGTTCGCGTCGTCGAGAGCCATCTTCTTGCTGGCCGATGA
GGAGGCAGAGGTGCTCACACTGCGACGCGGCGGCGAGCGGCCCGGATTGAGGTCTGCGGGACTCGGCTCCTCCGGAACCGAGAGGAAGCCTAGATTCATC
TGGGACATATCCACCGATAGCCCCGACGAGCGGTTCGGACCGCGCCTGCGAGCGGCTGCGCGGGGCGGCAAGTTGCTTCCTAACGACGAGCGTCGGCCGT
GCAGCGAGTGCACCGCCCCGCTGGCAATCTGAGGCGGCACCTGGAACTGGAACTGCTGCATGTTGGGCTGTGGTGGCGCCGGGAACATGGTCGGGTCCTG
GAAGCTGGCGAACGGGTTGGGGTACCCTTGGTTCGGGTTCATGTTCTGCTGCTGAGCCGACTGCATCTGTTGCTCCTTGGTTTGCTGCGCCAAAATGCGG
AACTGGTCCAGATTGTGAAGCAGGTCCACAGGGTTCGAGTGGTGCCTCGAGTGGTGGTTCACGGGGCGCTTCCGCTTCATCTTGAGCTCATTTACTCCCT
CTTGGATGCGCTGCGAGCGGTAGGCGACGGGGGACGCGCCCCCATTAGTTCCGCCATTGTCGTCCGTCGTCGCTGCGTTCACCACCGGTACCTGTTGCTG
CTGCTGGTCGGGGTTTAGCTCCGACCACGATAGTTCCTTGAGGAACTCATCCATTTCTTGGAACGACTCTCCCTGAGGCGTCGCGGAACCCGTGAACGGC
ATGGGGTTGGTGATCGGGGATTCCCCATGGACAGGTGCAAAAGGCATCATGTGTTGTTGCTGGGGAAAGCCCATACCGTTGGGCCCCATGACAGGCGTGG
AGATGACGCTGGGAGCCATGTTGGCCATGCCGAAGGCCTGCAGCACGTCCGGATTGGAACGCACGCGCTTGTGTTTGTGCTGCGGCGCCACGCGGTAGTT
GGCCCCCACGGCCGTCGAACCGTTCGGGTTGAAGGAGAAGGAGAGTGGCGTGAGCAGGTCGTCGCTCTCGGCCTTGGGCGCCATCATGTTGGTGGGCGAT
GAGCCGGGCACGTCGCTGTCCAGCAGCATTTGGTCGTCGGGCGCCACGAAGCCGGCGGGCGCGTTCACAGAGCCGTCAGCGGGCGCGTCTCCTCCCTCGA
GGAAGTTGTAGTCGAGCGGCAAGCCGTCGAACAGGTCAGCGTCTGCGCGTCTGCCATGGGGACCGGTTGGGAGAATTCTGCTATAGAGGTCGAAGCTCTT
GTGAGTTCGGTGCGTGCAAATCGAGTTTGGAAGGGACTGGTGCGACAAATTCATGCAGCCTCGGATTGGTCAAAACTCTCTAAACCCTAGCCCTAATCTA
CCAGCTGCCGCCTTGATTCAAAATGGCTACATTATGCAAGCGGCGGCGTCGCAACCGCACTGCAACGGCTTGACGTGTTTGCACGCATCACGTTTGCCGC
TCAAGACGCTGTTAACAAACACTTTCTTAATACTTTCTTCATACATATTATCCACGTGGGGAGGACGCGCGGTTACCCCTCGCTACAGGCTACAGAGTGT
GCGGGAACGCCATGGTCGGCGTGCCGCCGCCGAAGCTCGAGACGCCCATCTCGTACGTCACGGTCTCCGCCGGATGGTGCTCCACCGTCTGATAAAAGGT
TGGGTCCAACGCGCCAGCCCGTGCAGGATCTTGCAACAACGCCTGCAACAACGCACGCGATCGGCCGAACGCAGTCAGCAACCAATTTTCAAGCCCAGAT
CGCCCTCAAGCCGGCGCCGCGCCAACGAAGCGATGCCATCCGTGTCAACTCCAGCAACAAACGTTCGACGCGGCGGCGGCCTTCTTAGAAAAGAAATTCA
CTCACCTGCAGACTCAGCGGGCTCAGCTGCGACGGATCCTGTCGCGGGTACGGGTCCCACATGCCCGCGCCGTTTGCGCCAGGCTGCTGAGACTGCTGGC
CTTGCTGATGCTGCTGCTGTTGCTGCTGGTTGTCGCCTATCCGGGACATAGCGTCAATCTCACCGTTCGCGGCGGGGACGGCGGCCGGGAGCCAGGCCTC
GCTCCCATTCTGCTGCTGGTCGGTCTGATGAACAGGAGACGCGCTTTGGCTTCCAGTGGACGTTTGGCGCTCGTAGTATCGTGGGTCATAACCATTGTTG
GTCGCGTACTCCTGACCCTCATACTGCTGGGGTGGGGCGTAAGGCTGCTGAGCGTAGGCAGCGGCGGCATACAAATTCGGGTCGCCGCTTGGAGAATGGC
CCATTAGCATGCCTCGGTTCTGTTGGTACGGCTCCGCCTTCAGGTCCTCCGTGAGCATGGCGACGTGGCTAATGTGTTGGCCCTGCTGCATCTGCGCCTG
CTGCTGCAAGAGTTTCTCGTGGAGACGCATTTGCTGCATTTGTTGTTGCTGATCAAGCTGCTGCACTGCTTCGGCGTTATGCGCTTGCAAGTGCTGCTGC
TGCTGCAGAAGTTGCATCTGTCGCTGCCGCATCAACGCCGAGTTGTTGTATCCTATGGCCGCCTGTTGTGCCGCCGCAGCTTGCGCTTGCTGTTGGTTCT
TCTTATGCTGTGCGTGTGAAGCCGCAGCCTTGCTCGGGTTCTGCTTCAGCGACTTCCACCGGATCTTCACCGAGTCCTCCGTACGACCCTTCAGAAGCTG
AGAAATCTGCGACCACTTGTTGCCGAGCCGTGCTTGGGCGGTGAGGATCACCGAATCCTCCTCTTCAGTGTAAGGGCCCTTATTAATGGCTGGATCCAGG
TGGTTCTTCCATCGTTCACGGCACTGCTTGGGCGTACGTCCTGGGATACGCTCAGCGATCTGGCCCCAGTTGTTGCAGCCTTGGGTCACCAGATACTCGA
GCACTTGGTCCTCTTCGAACGACCAGTGCCCCTTCACCAAGCCCGGCTTTAGCACCTTGCGCCAACGCTGAAGGCACTGAGCGTGATTGCGCCCAGGGAC
CAGCTCAGCAATAGCCTTCCAGTTCTTTTCGCCGTGGATACGCACGCTCTCACGGAGAGCCGAGTCTTGACCCTTCGTCCAGCGCTTGGTCGTCGGAGCA
TCCGGGTCTTCCCCCAGCTCAGTGTTTCCATTTGAGTTTTCTGCGTTCTCTTCATTAGCTGCCACCGGCGTTCCTGCATCGGAGCGGGTGCGCTGCGTGG
GCTTCTGCTCGCCTTGGACAAGCGTGCGGCTACTCTGCGGACGGTCACGCTTTGCTGCAGACACGTCGTCGTCCTGTGTCGAGAATGTCGCACTGTTGTC
TCCCGGGATAAAGCCCTTCTTGTTGATTTCCAACTCGCGCAGGTTCAACTCCGAGTCTGCAATGTGCGAGTTGCTCAGCAGACGTCCCACCTGCGAGATA
TCTTCCTTGGAGATCACCACCGATGACGAGGACAACGAGCGTCCAACGACAACACCGTCGGCGTTGGGCATGCCCGCTAGGTGCTGGGCCGTTAGCTTAT
GCCCATCAGCCTCTTTGCTGGAAATTGCACAAAACGTAGAGCAGTTAGCGCAATTAACACAGACAATAGTTGCACTAGGATGTCGTACCCATCGGGGCCC
ACCACGGCATTGAACGAGTGGAACTTGTTGGCGCCGCCGTTGAGCATCTTGACGCGGCTGGCAGCTGCAGAGAGAGAGCAAAACGTTAGCATCAAAATCA
TGGAAAGAAAAATGATCTGGCTGAGCGCACCGTTGAGTGCCTGCTTGCGCTTGAGGTGCGACTCCATGTTGTGCTCCTCCTGGGCCTGCACCTCGGCCAG
CTTGGCCTGCTGCACGAGGAACTTTTTGCGTAGATTCAGGATGAACTTCTTCTTGCCCTCGACGGTAGACTCGGCCATGGCTTTGATCACGCGGAACTGC
TTCTCGTCCCGCAGGCGGCCCACGTAGCGGCACAACTCGCCACTCTCGCTCGGGGACAACCCGCTGAGCGACATGAGGAAAAGCCGCGAGGCCTCGGCAG
GCAGCGACTGCAGCAGCTGCGCCAACAAGTCTCCAAAGTTGTCGGTCGCCGCCGATTCCGTGGGCGGCGCCGGCTCCGGCTGGTTGTCGATGGCCGTGTC
CGCCATGCTTGGGCCGTGTGCGTGTCGTAGAGAAGAGGGGCGGGTGCGCGCGCGGGCGAATATTGCCTTTTGTCTGCCAGCGGTCGTTCTCCCCCTTGTC
GCTGCGGTTTCCCCTTCCCCT