Description :
From Genome Similarity Track
Location :
Scaffold_29:136238- 139095
Sequence
2857 bases(100 bases per row)
tcaaacaaccgtaactggtgcataagatggaagagaaactattcagctgcgagccgaagcggcagtagaagcagcacgatatcgtcaaggtgccggcgac
aaggagtagtagaaggagcagaaggtggtgaagcagcaaacggcggttaaggtgccggggacaagctgtagaagcagcagaaggcggtgaggtgccgggg
acaagctgtagaagcagcagaaggcggtgaggtgccggggacaagctttagaagcagcagaaggtggtgaggtgccgggggcgacctatagaagcagcaa
aaggcggtcaaggtgctggcggcatgcaccaaataggttgtttatagtcaaggtgatcgccagtgacgtcttggaggtgcagcagcagtggtggcgaccc
ggaaacgcgtatacaccagtattatggtgaactctcaatttcaaaatcaacattgagaaagtaagttaattgtcgctgtaccgaacatccttacgccttc
acctccattcttcctttgacattatggattgtaagcgaaaatgtgttcagacgactgtagaggaggaagtgaagaagctcaagaagtggcaacaaaacct
ccactggaagccgaccgaagcagcaaaggaactgggggccaaaaagggggcgcttttgggctggcgaaaagagctgtcggacgtagacctctcttttgtg
agagagtcaagattggatggggggcgttttcgaaagtctggagcagggcctaccctgaagccaaggacgtacgagccgcaggtgtttgagtattttaagg
catgtactgtgaacggtggtaaaattacttcgacagagttacgcaaatattgcagtcaatttccggaatttctactggagagtgacagtgcctcaaatga
cctattggtggacaagaacgaagtaccgtatccagttgaagaagtagaagtgcggttccctgttgaagcgccattgccattggaagggacgtcaacaccg
gaaggtttgtctccagctacagtgtcttcgttagaaggaccatctgtacctgaggagttttcactggaaatgtcaccacccgctcaacagtcgccatcct
ctgaactccacccgtccgttaaagaggcggtgtcacaagattgcccagcagactcacgaattcacgaatatcgaagacctcttttgattaaaagcctggc
agttgctctttccaaaactccaacatacggagctatagcttctctcaagaacttcactctctttcaattccgaaagttacagcacatctgccgaagaaaa
tgcctctcgcctctcttattcaaccagaaaagatcactagcattttacctgaagaagttatacggaagtgcaagccaatattagttcctttcaagtcaag
aaaaagaacgttcccgaaccggacatcgtgtcggctatcgacactgtaggtggttttacgacacccgccatcagaaccatgcaccaaaggcactcagtcg
tcaaaaccctggaagcagtaaggaagactttgcgatggctcaagcagattgacctcgccttggagattaatgatgacttcaaggtacctcagcgctccaa
cctcaaagaacgtctgaaagaactccctatcacttcgttacaggtatcgtttttttttcttatttctatttacttttttgaatgctgaatatcaatttgt
tccaggtagagcagctcgacattggcggaaagggtacattcggggatgccacaatggaaattcttctctacaaattatttggggggcgagaaaatgtcgt
ttacatcaagccaacgagtttgggtgtaattgtgaatggctctttgggtgtaattgtgaatggctccacagctctttaaggaaccagatctgcgaaagct
ctttgctttcattggtgttcgatcatggtaagaccgaccacgtccgaacttttctactatgacccgatgtcatccagttttggtgaacaggccaagaaat
tttcggaaagaattcaaccgctgctttaattttccggacctacaagagctcgagtccgaccatttgtttcgagcctcggtgtacaggtcgacagctacaa
ctgcggactttttgtaatggtggtcttcgaaaggttctgtggagcggaatctcctgggatccgaagtaaacgtttacttcagtacttacgctatcggtac
ttggacatgtgtatgtctcttgagagaccagtaaaagttaaccgtacttagcatgatatatagttaaccggttacgtcggactgtggtacaagatatctc
gactcggtcgagtaaactagtatcgtggtacaagatatctcgactcggtcgagtaaactagtatcgtggtacaagatatctcgactcggtcgactaaact
agtatcgtggtacaagataactcgactcagtcgagtaaactagtattattggcaaaatgaaaggcgacgatacaattgttgctgctctgcaaacgttaca
ataataggactcactgcatgcacgtttaccgtagaacaggagatagataatatctataagcaacttcgactaggtagtgtatgttggttgaatagcatgt
attatgaagtatacgctgtgattcatgggctggcccattcgtttgaactgatcgaagcgtatttactaattctaaagacacagctgtgaatattgtctta
atagtaggatctctccatttcaaaagcccttgttgatagcagtggtcagcctatacgtcgaggaggggataaaccaaataccaagttgctatggatgaat
atcattaaatctctgaccatacttaatgattgtatccgctagaacagtcaatcatat