Description :
From Genome Similarity Track
Location :
Scaffold_798:13623- 15370
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_798-snap-gene-0.8Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_798-snap-gene-0.9Reverse transcriptase

Sequence
1747 bases(100 bases per row)
GGGTCATCCTCCGGAGAAATGCAAGGAAGTTTGCAAGGCCTGCGGCAAGGTTCATGACAAGGGTGAGTGCGCTTTGGAGCGCGCGTTCAATAAGCTCTCT
GCGTGGCACAACTCGACATGTCATGCCGATCTTCTCCCACCTGAAGTCAAAGAAACTTTAAACATGAACGCTCGCTAGCTGCATGGGGGCTAGAGTGCGC
CGAGTGTTCACCCAGTGCTTGCAGTAATGTAGGCAGGAAGGGAGCAGTTACGGCGAATACAATCGTTGAAGCAAAGACTGGTGTGGAGAAGAAAGGATCC
GACCTGGGTGCGACTGTGGACGAGTTCGATCGATCGACCGTGAGGAAGATCATAAAGGTCCGGCTCCGTCCGCATGAGAGAAAGGGTTGGTGGAAGGTGG
TGAAACCGAGTCGGTGAACTTACCGTGCCAAGGCGCGTGCTAAGATCAGCGATACTGGGGCGATGGTGCTGTTTGATACAGGGGCAGAAGTGTCTCTGAT
CAGTTCTAGCTTTGCGCGCAAGCCAGGAGTGAGGATTGGCAGCTCTGAAGCTCTGACGTGTGAAGGAATTGGTGGTGGTGTGTACGAGACGGATGGATCC
TGTGTCGTGAAGTTGACCTTAGCTAATGAGCTTCTGTACAAGCTGACGCTCTTGGCTGGTCCAATGGAAGGACAAGACATGATCTTGGGCTTGGACTTCA
TGTCCAGAGCTGGTGTGCGTGCGAGTGCAGCGAATGGCTCAGTGCGTCTGCCAGACGACGTATACGTGCGGTTCAAGGGACGCCGACAACTATTCAGCTC
TCATGCGAGACCGATCTACCCTGATTCAGTACGGATCGTCGATGTTGGAGGCCGGACCGAGGCGAAGGCAGGCAGATCCAACGATCAAGTGCTGTGGATC
CGTCGCGATAAGGCTTGGGTGACGAGTATTCGATATTCTAAGGCTGGAACCCCGCTTATGATTCGAGTTACGAACGTCTCAGACGAGCGGATCCAACTGA
ATATACTGGACCAAGTCGGTGTGTGGATGTCCCGCGGCACTGTCCCACGAAAGCCTGGGTTTGTGTCTGACGGATCAAGACGGAGTGTCGAATGGAGGAA
CCTCGCGTACTCTGCAACCTCGGATCAAGACAAGATTAAGGTCGAGAGCGACACTGACGAAGGACCTGCGGTCGAACGTCCGGACTATCCAACGCCTAAG
ACCATCCTAAAGCGTGATCATGGGCAGAGTAAGCTGAGCGGTGTGGATCAAGTGAAGTCAGTCGCCACTGTGCGTCCGAAGGCAGTCGTACCCAGCTCAC
TGAAGGGACCTTCTATCGCGAACCAACCTCGAATCCCGTTCGTGTCGAGTGTCGAGTGTTGAGAAGCTTGATCTGGATCAAGAAGGTGCTGCAGCCGAAG
TGGTGATAATAGAAGCCGGTGATCCGAAGCTAGAAGATCTCGAAGCCAGCTTTGCAGTAATACCCGAATTCGGTCACGAGTCTGATCCAACGATGAAGAA
TCTGGTGAAGATCGAGGATTTGAAGGTCAGTGACCCGTCTGCTAGCTCTCAAGAGGGTCGAGATCGCCTGCATGACGTGATCTGGAAGTGGAAGTGGAAG
CGGATTCTGATGAGCAAGAGTGGTGCCACACCGCCTGCGGCGAACGGAGTGATCTGCGACATCGATGTGGGAGACGCAAAGCCCGTGGCACAGCTGGTTC
GTAAGGTCTGACCAGAGTTCCTGGAGAAGTTGTTCGTGTTGATTAAG