Description :
From Genome Similarity Track
Location :
Scaffold_210:13623- 14627
Transcript NameFunction/comments
g10633.t1RAW31201.1 hypothetical protein PC110_g12446 [Phytophthora cactorum
g10634.t1hypothetical protein

Sequence
1004 bases(100 bases per row)
CCGTCGTGTACACAAAGTTGCTGGGGACTAATTTGACGCCGCGAAGTAGGTCAAAGCCCTTCAGCGCAGCGTCAAAGTCCTTGGTCTTGTAGCAACAAGT
GACGAAATTCGCGTACGCGGACACCTGCAGGTCAACTTTCTGCTTCCCGCAGAGCTCCAGCACCTGCACCGCCCTGTTTAGCTTCTTCTCGGAAACGAAC
GTCGTTAGGAGCGTGGAGGCCACGTCCTTGGATAGCCCCGAGCCATTGGCGCTCTGGATGGCGGCGAAGACCTCCAGAGCCACGTCGGTATCGCCCGGTG
CCGCCCTCAATCGCGACAGAATCGCGTTCTGTCGAGCACTTTCATTGGCCGAAGCTTTGGGGTTCTTGGCGCGGCGAGTTCGCATTTTTTGCAGCTTTTG
AGGCGGCTCAGACGGTTCAGGTACTGGAATCTGCGATAACGCACGACTGGAGACGACAGCGAAGCAGTTCCACGCCAATGCAGAAGAAGGAGTGACGTAC
GGCGCGCATGGTAGCGCCCTGGTGGCGTCGTGGAGCAGCGAAACGTGGCGCCCAGAGGCGATTGCGCAGCGGATACTCTGACGCAGCATCGTTTGGCCAA
TTTGCGTTTTGGGATTTGCGTCGAGCTGGAATTTGGTCTGATGTAACTGATCTCGAGTGCATCAGAAGCCGTCGGTGCATCTTACAATCAACGTGTTTTC
GATACAGTTATCGCTATTTCCTACTGCTAGCTCGGCGCCCACGCTGTTACCTACTTCATATTGGCGATGTACTTTTGGTCCAGTCCACAGCCAGAAAAGC
AAGACGCCTGCTGGTAAATGTAGAGTGAGCTAGTTCCACAACTCGCTATATACATGCCGCTCTGTACCATCCCCGACCTTGGTCTCTCTTTATGTGATGT
TGACGACGATGGCCGCTGCTAGTGCCAGCCCCGCACTTGCGGTCGCCGCTTGGTTGAACTGCTGCTGCTTGCGTCGCTGCTGTTCCTGTTGTTGCAACCG
TCCG