Description :
From Genome Similarity Track
Location :
Scaffold_394:13622- 18916
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_394-fgenesh-gene-0.3CG17669-PA
Pytiw_DAOMBR242034maker-piw_contig_394-snap-gene-0.4Di-N-acetylchitobiase

Sequence
5294 bases(100 bases per row)
TTGCAGACGTAGAGCACGCGCTGGTCTTCCTTCAGCGGCAGCAAAAACCTATAGAGCAGCAACACAGATAGAGTGGTTGTTAACAATCTAAGTACATCTG
CATCTCATAACTGCTTTAAGCTACTTACACGGACGACTCGATGCTCACAGCTGCGTTATCAGACAAGATGCTCGTGAAAGCCTTGGACTCCGTATTAGTT
TTCTCTTGCAACGTGTGGCTGTGCTGCGTCGAGAGGAAGACGTGGTCGAACTTGCGGCTGTAGCGCTGTTTGCCATACAAATCCTCCAGCTCGCCAGTCA
GCGGGATGATCTTGACGCTGTCAAAGGTCTCGTAGATCGTTTGGGCTCGCTGGCGCGCGTCGTTCTCTTTCGAACGTTGCTCCAGCAGCTCTCTGGGCAC
ATGACCAGTTGGTATATAAGTCAGAATGGCTGTCTAGGAGCCCGTTGATCCCACAATAGGTCCACTTACTTCTCAGAGACGGCCTTCGTCTCGGATTCCT
GGTTGGCTCCCTCTGTTTCTCCATCATCCAGCTCGACAATTTTTGGACGCGAGGCTTCCTTTGTTGTACTCTGGTTGGTATCACAGGAGCCTTCCTGGCC
GAGCGCCGACTCACCAATGCCGCTGTACACGTCGTGGGCCTTCTTCATGGTGTACTGTTCGCCGGTCTCCATCTCGTACAGGTATGAGAGCACGTTGAAC
ACGGCGACCTCGGTCGTGTTCTAAGGTCAACCATGCAAATACCGAGTGAGATAGCAGCCTCACACTCAATAGACTGACTAAAGCAACGTACGTGTCGGTT
CTGCTCGACGCCCGTGCCTTTGTTGTGGATTTCGAAGAGCTGCAGCGCGAACTTGTGATGCGAGGCGCACTGGACGCCGAACGAGAAGTACGGGCCGATG
ACGACGTCCGTCCAGAGGCCGCGGCAGAGCACCGAGCCGTGGTGCTTCTTACGAGCCTAGAATTTTCAAATAAAATTGAGTCGCTGAAACCTATGTTCGG
GTATATACCATAAGATGCGCATATCGTACCTCGGTATAGGCGGCCATGGTGCGGTTGGGCTGTTTGTACGTCTGATCGCCGAACTCGTAGGCGATGCCCG
AGTTGCGCCACTCGCGGAACTGGCGGATGTGGATCACGCTCGCGTTCTCGAGCTTCCTGAGGCTCATCTGGCAAACGTATAGGCATGTGTATGGTCAGAA
TCGTCAAGTAGATATATTGAGGCAACAAAGTTCAAGGCTCACGGTGTAATCCCAGTCGATGAGGTTGTTACGGTAGTCGTAGCGCGCTTCGTAGAAGTGG
CGCAGGCGGTGGTCGCGGAGTGTGTCGACTACAGCAACACGTCTTGTTTAGTACCACAATCTTCATTAAGCAAGCCAGCTGTGTATATAAGTACCGACCG
TCGAAGCGTACTTGTTGGAACCAGCTTCTGAACGTGTCGACGAGCTCGTCGCGGTGACGCATCTTGAGGTGCGAGAGGTCAAAGAGGTCGGCCAACAGCC
CGCGCTCGTTGTGTAGCAGGTCGATCAGGACCTTGGCCTTCTCTTCAATGTACGCGCTCGTGCGCTCCTGATACATAAGTCGCATCACAAGTATTGGTCA
TGAGCTTAGTCCAAGAGACATCCTATATCTTATGGACGCACCTGCACGCGCGCGTTGCCAAAGACTTCGAGGAAGAGGTTGCATCGCTGGCGCAGCGGCA
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNAGGAGGTGCCTTGCAAGCGCCTCGATCGACTTTTCGTACACGTAAATGTGCAGCGGCCTCGCTCTTGTCTTGTCGTGGCGCCGGCGATGCGCGA
TCGACGCGAGCGCGTGGCGGACGTCGCCCGGTCCGATCAGCAGCACGTTAATGGGCTCCAATGTGGGTTTATCAGCGCCAGCGACAGGTGGATCACTGAC
TGCGGACTCGAGCGCTGGGATGTCGTGCAACATGTCAAAGCCGGGCGAGAAGCCCCACATGTTGACCGTTCCCATACTCATGAGCACGCTCTTGGACGTC
ATGGTTGCGCAATGAGACAGATGAGATAGACAGCGAGAGTGTCTGAGTGCAGGTGGAAGATGTAGCACTAGGAATGGTTCGAACGAGACACCTTAAAGCG
CAGAAAGATCCGCCTTCTCGTCTAGTGGCTGCTCGTATTCGCCTGGTGTCGAAAGGACGCAAAGAGCTCCGATCGCTCATTGGTCATAAATCTAGAATTC
TATCATTATTATCCAATCAAAACAGTTTTGGTGAGCCCGAAAAAAGTGATTTTTTTAAATCGCATAACAAGAATTGAAAAGAAGTTGCATGTCGGAAAAT
GAAAATATCAGTAATTTAAGCGCGACGTACTGAACTCAATCCTTACCGCTGACTGCACATACATACAGAAACATGAGTTGGTAAAACATGGCAGCTGTGA
TATCATCGTGCTAACAAACCTCCCATCGTGCAGTGGAAGTATTGGTTTACGACGCAGTTGATGGAGGAATATATGGAAGAGAAAATCACATGCATGACTG
CATTTCGAGCTTTTAGCATCAAAATCCGTCAAACCATTCCGAATCGCGACTCGTGGGTCCCTCAAAATCAAAGTCAGTTCAAAAAATGACCTCGATTTTG
AGTGACTAGGAGAAATGCGATATTTAAATCGCTGAAAATTGCAGTCCTATGCAGATCTGTGCTGAAAATACGACTCATGTGGGTCGTTCATAAGACCTTT
TTCAAATTAAACTTTCATACTCAAATTTAATCGTCAATAATTTTAAAGCCATACCGATAGGCTGTTCACGATGTGCTCTTCGTGTCACTCAAATCAATAA
TCGAGTCAAAGGTTTTCTTGGTGTTTTCTTCTCATTTCTTCAGTCTCACATTCGATGTTTTTTCTCGTTTCCTTAGTCTCGACCAACTTTTCTGAGAGAA
ATTCTCAATTTTATTTTTAAACCAAATGGTTTATTATTCTGTCTTTAACGAGTAGTCAATCCATCAGCTCTAGTATTCTGGTACAAACTTATTTATAATT
AGACCCCAATGGGCCCTTAAAAGTATTTTTTTACGGGAATTTGGTTTGGTACAGTGTACCACCCAATCTGAATCAGATTGGATCTCCCCATCAAAATCAA
AATGACGCGACCAAGACGCCGATCCAGAGGGCTGCTGCTGCTGCTCTCCCTGTGGGCGCTGTATGCGGACGCACGCGCTGTTGTGTTCAGTTACCAGAGC
TTCCCGGCGCAACAGCAGCAGCCGCTGAGCGTCTTTGAGCGCACTGCGCTGCGCTCCTGTCCCTGTGAGAAGCCTGAATTGTGCCTGCCCATCGCCGACA
TTGGCGCAAACGCACGCAAGGAGGTGTTTGCGTTCTCCGTGACGACGTCGGACCAGTGGAAGCTCTACGACTGGAATCAAGTACGTGTAGCTGGGTATGT
AGACGATTGGGGGATGCGTAGTGCGTATAATACTCATGCGTTGGGACTCGTGTGTGTGAAAATAGCTAACGACCGTGGCCTGGAACGAAGACAAGGAGCT
GCTCTGCCATGCGCACAGCAAGGACGTGAAGATCGTGATCAAACACAACTTTGACGACGTTGAGAAGCTCTGCGACGCGCAGTTCAGGAACCAGTGGGTC
CAGGTGAGCGCTAGAATTACCTGTGTTGAGTTTTCTAAACTCACGATGAATTATTTATTACGTGTCTTAAAATAATACTTTGTGAGCAGGAGACCTACAA
GCGCATCGTGAACAGCTTTGCGGATGGTGTGAACATTGATACAGAAAAGGCGATGCACGGAGCCACGGCCAAGTGCATGACCACGCTCGTCCAGGAATTG
CGTCGCGAGCTACAGCAGCATGCGTTCACGCAGCACGCGCAGGTACGATTTATAGTTTTGTGTGGTTATTTAGCAGTGAGTTTTTGTTATTGATGCCATT
ATTTTGCTTGTAGATCACGTTTGACGTGTCGTGGGCACCACGTGGAGTCGATGGGCGTTACTACCAGTGGAAGGAGCTCGCGGATGCTGTGGATTTTCTC
TTCGTCATGTCGGTAAGTGTTGTACTTAACCTGTGGGTAAAATATATTCACAGGACACTCACAACGCTGTGTGTACTACTTCGATATATTGCAGTACGAC
ATGCGCAGTCAGATCTACTACCAGTGCATCGCTGCCGCGAACTCGCCGCTGGCGCTGGTGAAGCAGGGGCTGGAAGAGTTCATCTTTGGCTTTAGCATCG
CCCCCGAGAAGCTCGTGCTCGGGGTCCCCTGGTACGGCTACAAGTACGCGTGTGTTGAAAGTGATGGCTCCAGTGCGGGCTCGCGATTCTGCTCCATGAA
TCCGGTGCGTTCTACGATAACAAAATTATGCCACGTATATTATCCATGAAGCAAGCCACTCACGTACTTTATTCGTGTGTGTGCTTGTATTATATTTATT
TCATTTATTAGACCCCGTTCTTCGGTGCACCATGCAGTGATGCAGCCGGCCAGCAAGTGGACTATGGCGACATCGAGAAGCTCATTGAGCGCGAGAAGTC
CCCTGTGCAGTGGGACGCCGTGACGCAGTCGCCCTTTGTCACGAGCGCGAATGGCTCGTACCAGATCTGGTTTGATAATCCGCAGAGTCTACGGCTCAAG
TACCAGCTTGTGCGAGAGCTGGGGCTGCGAGGCGCTGGCATGTGGAACGCAGACACGCTCGACTATGCGTCCAGCGGCAGTGGGGCGCATGCGCACGAAA
CGCAGGCGATGTGGCAGGCGCTGCACGCGATCACATGAGGCAAAAGAGCACAACCACACGCACGACAAAGGTGACGATCGCGAGGATCCGAAAATAATAT
CTGCAGATTATCTGCAGATTTTCATGGACTCTTAACAATTTTTAAATATATATGGACATTTATTGGACATTGAATCGGGGCGGTTACTGCTTTAGAAAAA
GATTTTTTTATTCGAAATCGTCCTGTATGACGCATACAACAAGTCTTATAACATCTAAATTGTGATGCACTGAAATATGATAATATAAATACAGCACATA
AACTGCACGGAAGTTGAAGTTGACTCGCAAAATGTATCCATCTGTCTTTTCGCCCCAAAAGATTTTCTGAAAAAGTGCAGCACTGGAACGACCC