Description :
From Genome Similarity Track
Location :
Scaffold_456:13620- 14945
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_456-snap-gene-0.19Choline-phosphate cytidylyltransferase B

Sequence
1325 bases(100 bases per row)
GCGCGATGTGCCGCTCTTCAAGCCGCTCTCGTCGTCGCTCATGCAGCAGTTCGCCGCATGGGTCACGGGCTCGCCGCCCGAGTACTTTGACTCGAGATTC
GTTGCGCAGAACGACGGCCGCGAAGTCACGCGCGTGTGCTCAGCTGGCAAAGTGCGTCTGGCGCTTAACGTCGTCACCTCGGGTATGAAGAAGCACGGCT
ACGCGTGACACATTGTAATGAAAGCAATACCTCCATGTTGTTGCGCTTGTATTGGTTTCTTCTCTTCGTCTTCTTCTCCCTCTGTTTTGTCACCTAGTCG
TGATGTTTTTGTCGATTTCAATATGCAAAACAAAATATAGCCAACATTGTCAGTCTCAAGAGAGCAAGCAAAGGTTCACTAGCTACCTTGCGTGCCCTAT
TCTCTCTCGTTTCGCCTTTTTCATGAGCGCAGTATCTGCTGGTCGCCTGGGCTATGGAGACTAGCATAAACCCTCGCGCGCCATGTCGGAGAGGCGCTCC
GAGAGTCGCTCCTTGATGATCTTTCGGCGTTTCCGGAACGATGTGCGCTGTTGAGTAATTCATAAACACACAAAGAAGTTAGCCTTGATCATCAGCTCAA
AGAGAATGACCAGCAGGACTTACGAGGCGGCCGTCCTTGCTGAAGAGGTCGAGGAAGCCGTGCTGCATGTCCTCGGCCTTGCCGACCCACTTGTGCACGA
AGCCGTCGACGTCGTGCTTGACTTTATCTACTGCCATGTCGAACTTGATGCTCTGCTCCTTCATGAAGGGAACGTTCATGTCCTTGCCCGTGTAGCCGCG
CGCGAGGTTGCGCCGGATGAACGTGTCGTACTCGGCCACGATGCGGATGATGAGGTCGGACGTGGAGATGCCGTCCGTGCGCTTCGTCTCGAGGAATTTG
CCCATCTGCTTGATGCGCGCGTACACGTCGCCCTCGCTCGCCTCGCCCGACGCGTCCGAGTACGGCAGCGCGTCGTGGCACACGTAGTCGATGTCGTGCG
CCTCGAGGAACTCGTCCGTGATCACCCACGGCGCGTCCTCGACGACCTCGTCCACCCACCGGCAGTGGCGCAGCGACTCGTAGCGCTCCGTGTCCGTCAT
CACCGTGCGTCCCTTGAGCTTGTGCGTGATCTCGTCGCCGCAGCAGCCCACGATCAGGAACGTGTTCGGGTACGCTTCCTTGCACTGCTGCAGCGCCTTG
GCGTGCCCAAAGTGGAACAGGTCGAAGATCCCGTCCGCGTACAGCCGCAGCGGCCGGCCCGTGAGCGTGCCCGGCTCGCCCTCGACTAGCGTCTTGCGGA
ACGGCTCGTAGTCGTCCGTCTGCGG