Description :
From Genome Similarity Track
Location :
Scaffold_273:1362- 3917
Transcript NameFunction/comments
Hyaar_Emoy2813421hypothetical protein

Sequence
2555 bases(100 bases per row)
GAGTTGAACTCATCTTCGCTTCTGGATGGGGTTGTTCTAGGGGACACAAAAGCGGTACTCAGTGCTTGTAGTGAATCATCAATATTGATTTTTTTACAAT
ATTATTATCCTAAAGTTAAGATATTCATTGACGTCGTGTGCCACTACCCACCCTTTGTCTTACCTCCAGATAGGGTTGTCCGTAATAAAATTGACTTGGC
CCCTAGGACCAAATATTATGTCACACGTTAGTCGCCCTTCCAAAAGAACAGTGTGATGTCATCGATGACTTCTTCCATGCCAAGCACGAGGCAGGATTAG
TACGTGAGAGTAAGTTCCACACTTGACACCGACCTTTTGTGTCCATATTTTAAGATGTAGTTCTTTATAACAACATGGTAGGCTGGCCATGTACAGTGCA
TTCAAATTAGTCGGTGGAAATTACCAATTTCTCATGCGAGCGAGTGGAATTTATCTGACAGCATTGAGAACTCCGAGTGCTATGCCATGGGAATGGCTGG
GTATGTCTTAAGGGCTTTCCAACGCTCCAGCTAGTTTAATCGTCTGTTGACGCAACGTTTTGTCTTTAACGGGTCATGCTCAGACATGCTTTGATGATGT
TTTCGTCCATAGTAGTTCCGAACAGGGGCGTCAAATGTTGACAATTACCATAGACCAGTTTCGAGCAGTACTTGATTGCTTACGCACGAATAAGATGTAT
GACAATGCATCTAAATGTATATTCGGTGCCATTTTAAAAAGTTTCATTGAGAAGGTAGACCAAGAGTGGATCCTGCTCAGGTCATAGCTATAGTTGACGG
GCCGATTTGTAAGAATTAAAATGACTTAATTAAGTAGCTTGGCCTTACAATTTACTGAAACAAATATAGCAAAAATTGGGCTCATATGGCTAGTCCATTT
ATAAAACTCTCTAAGAAAGAAACGGAGTGGTGCTGATATACCATCCATGCAAAGTAATGGAATGTAACCTCCATGCTCCTATTTTATGTCACCTGGTTAC
CCTTTTAGTGTCGTCAGTGACTCAATTGATTTTGACAGAGGCAGCGCCCTGTTGCAAACATATGCTGTAGGACCTGAGCTAATCAGTGCTTTTAAAAATA
TCTTCATCTCAAGCAGCTTAAATAACTATCCATTTCATGACAAATAGTTACTTGCCATAAAGAATGCACTAATCAAAGTTAGACCTCATCTGCTTGGCTC
CAAGCCATTCGACTATACGGGTCATGCATCGTTACGCACGGCGACATAGTCGCCTCACCTCCTTCATATATTGGATCGTGGGCTTTCATGATTTTTGGCA
TATCACTTGGAGAAGAGGTATAAGCAGGGAAAACGCATTTTTTAGTGGATGCGCTGTCCTGCCGAGAATTTGATACTTATGAAAATATTTCTTTACCTTA
AACATTAAAAAAATAGGATCAATGCCACACATTAAATATTGTGTGTATATGACGCACGGATAAAATCCACGAAAGAGGACGCCAAGTTTTTAATTATGAA
CATGCTCAATACTAAAAATTTGGCGTCCTCTTTCGTGGATTTTATCCGTGCGTCCTATACAAACAATAATTAATTTGTGGCATTGATCCAAGCTCTTGAG
AGCGTATTATACAAAACTCAGACACAACGTTGTAGTTATAGAAATATGTAGCCTGCATCGATATTCCATCGACTGTGACCTCTTGTAACATGTGATCTAC
GCTTCGTTGTGCCCCACGATGAAGATTTAAATACGGATCCTCTTTGAGGCCCATAGTTCTATTCTCACTAGACATTTGAGCCGATAAATATACTTACGGG
TATATGAGTCATAAGTTAACAAATTAGTGAGCACATATGTGCGCAAATGCGAAACGTGTCAAGGGGTCAAATCTTCGGCTCACTCGGCGGGGCATCCCGC
TGGTTTACCCGTACCCACTATATGTTGTATCATCTTCAGCATAAATATGTACTCGGTCTCAACGAATACAGAGACGTCAATACAGGCTTCGTGGTCTTTG
TTAATCGTTTGAGTAAAATGGATCACTTAGCTGCTGTGTCGGACTCCATAAATGGTAAATATACAACTATACTGTTTATTTATTGGTGTTTTTTTAGCGC
GGCTTGCCGATGGAACTGATCGTAATCCTCAGTCGAACGTTTAAGAAAATAATCATTAAGGTTCTTGACTTATGAGTGGATATTTTCCACACAGGAACGC
CCGCAGACCGACGTCGTACTTAGCGCGTTAAACGCGTCGTCGACGATGTTCTTGGAATTGCTTGTGCTGAGCCTCCGAATACTTGGAGCTCGGTAATCCC
TGCCGTTAAATGTGCGTTGAGCAGCGTTCTTCATGCTCTCACCGATTTTTTTTCCTTCTTCGCGAATAATCCCATAGATCCACGCACCCCGTTAACGATA
CCACTGCGTGGTGCTGGGATTTGTGGGGGAGCGTTTGCCGACAAGATTGCTGATATCAGCCGTACAAATAAGGAGAAACATGTGGGTGAGTTCTCGCGAG
CGCTTCAGTGTCTTACGCCTCGTGTGTTATGAAATAGATGAAATCCAAGATAAAC