Description :
From Genome Similarity Track
Location :
Scaffold_1421:1362- 3816
Transcript NameFunction/comments
Phypl_g13365hypothetical protein

Sequence
2454 bases(100 bases per row)
CGTGCTCGGAATCAATCGAAAAGGAAACGATATCCTCGTTAGTCGGGCTTAGCGTAGAGATGACCGGCACTCCCAGTGAGGAAAGTCTTGTGGCGAAGAT
TTCGCAGCATCAGTGGAGCTCTCGCTACAGAGGTACGTTTGCTCCGCCCACTTCGGAGGCCGCATCGACGGTAGCTTTGCCTGAAAATCTGCATCGCTCA
AGCGCTGGTTGATCGGCGTCACGAACTCGTAGCTGCTGAACAATGGGCCAGCGTACATGACGTCGTTGATGACAAAGAAACCCACGACAGGGTCACCCAC
GCCCAGATTCAAGATGCTCCCTGGATCGCCGTGCTCCACTGACGGAATATCCGTGTGAACGTCCACGACCAATACATCGCGTTTGCCGGAGTCCTGGGGA
GAATCGTAAAATAGTCGGGGGTACCAACCGTTGTATTTGGTCGCTCCGCTTCCACGCGTTTGTTCCATCACCGACTTCACGAATCTCACTTGCTCCGCGT
CCAAATCCTCGCCTTTCACTTGGATGCGCGAGATTTCTTCTagcgtcttcatcgttgAGGCGAATGTCTCGAAGACTCGACACCCTTTTTCGATCTCGTA
TCGATTGCACGACGTACCTGCAAATGTGTCTCGCACTTGACCAGCGATGTCCTTCATGCGCTGCGCCAATTCTCCCATTCGTTGCCAAAACACCGGGTAC
GGATCCACCACTCCGTCTGGATATTCACAACGTGTTCCGCACGTATAGCTTTGCTTCGCGTAAAGCACTGTGtcgtggcggagctgcgtgAATGAGGCAA
GCTGCGTGTTCACCTGACGGCGCTGCCACGTTTTCGAGTGAAACACTCGCGCTGCATTGGGTGACGGTCTTGAGAGCGCTCGAAGTGCTTGAAGCCACAG
CGTACAGATACTTGCGTTTTCAGAGGCTGTACCGCTTGGCTTGTTgacgtcgccatcgtcgaactcctcgtcgatAACTTGGCGCAGCGCTATCAGGTTT
GACGCAAATGGGATCCCGTCACGGTGTGGCACAAATTCCATGTCATCACCACTCGCATCATCCGCTGCAGGTGCATGTGCCTCCATTCGACGAGCGATCT
CCGTGGCTACTTCGTTGATACCAAACAGCGTGAAAGCAACGTCGAGAGCGCTTGGTAGACGGCGAACCTGCTTTGTTCCGTCTTGCACCACTTGAGTCGT
GTGAAGATGAACGCGCTCCACACTAAGCGCTGACCAAGTAGAGCGAATGAAGTTGGTCGAGCAGTGggagttgctgctcctgcgaCGAGGTCCTCCACTA
GAGGATGAGCTGCTTTCCTATTCCTTTCTCTACAATCTGCGCTTGCAGACTAAGTAGAAGTTTCTCCCTCTCCAGCTCAGAAATGCCGGTCTTACCCAAG
GTCGAGGCCGCCATGTCCGTTGGAATCACAAGCTTGGCCAGTTTGTTCGCTGAAAGCGAGTCAGCTCCGATATCGCTGTCCGCAACGAGACACGAGATGA
GTGAATCGGCTCTTTCGACATCACCTAACCTGTCCGAGGCATGAAGACACTGCACTAACACGACTGCACACAACAACTGGTGCAGATCCTCATGTTGATG
GTCTCCACCAGCGATGCGAAAGTCGGTCGTCCCGAGCCACACCATCGTTCGGAAGTATCGCTTCAGTTCTTCCGACTTGGTATAGTGTCCACGAGGCTTC
AAGAGCGAGAAATCAACCGCACGTTGAGCCGAAAACACTACAAGATCGGTGGTTTGCTCTGCTCTAATTGCAGCCCACAGAGCGTTGAGTGTGGAGGatt
tctgctgcagctcacctTGCAACAAGCTCAATCCAATCGTCAAGTAATCGTTCACATCCTTCAGAGCTTTAGAGACCGACGATTCCGCTCCCGATGTGGC
TGACAACATTTCCTGGCACTGAACAAGCGATGAACTCAGCACTTTATCCAGCATCGGAGcgagctgcgtcgtctccaaCTCAACCAGGAACGCGTCGAAG
CTACGGTGCCATGCATGCAAAATCGAGTCCGTCGTCACGTACACGGGCAAGTCGTCCGTGTACAGTCGGTAGTAGACTTCAGCAAAGCTCAGAGCTTGCA
TCCGTTGTACTGCCACGACCCCATTGGCTTCCAGCTTGGTCTTGTCCTCCGGCGTCAAGCGGAAGTCAAACTGTCGGTTCTTCTTGAGtgggtggtggtg
cttggacgtttgcagttgctgcatgAACTTGACTCCATGGAGTTTctgagcttcttgacgttCCGTTTCCATCTCTTCCCGAGCTTTGGCTGGATCAGCA
TTGAACAAGTCGAAAAACTGgcacttctccagctcaaTAGGTGCGTTGTCTGGCAAAGACGGAGGATACCTGTCCACCAGGTCCTTCGACGTCAAGCATG
TTCCCGTTCGTGCCAAGACAGCATCGAATGTAGCTCCGATATCGCCTCCACCCA