Description :
From Genome Similarity Track
Location :
scaffold_106:13616- 15327
Transcript NameFunction/comments
g3698.t1hypothetical protein

Sequence
1711 bases(100 bases per row)
CCACGTGGAATCTGATTGCACCTCGCTGTGTACCCCGGCGCTACAGAACCTAGAAGAATCACTACCAGACTGCAACTACTTCCTCGAGGGCTACGAGAAC
AGCAACAAAAAGTCAGACGCGTTCAGTTCACTCGCACATTGCGAGCAGGGGAATTCTTCAGAGCCCGTTTCCATCCACTTCCATTCCAACTCAACGATCA
TGATCAGGACCCCGTCTTCAGCGTCGGGAAGTGCCGTGATGGATGAAGTTTCAGCTTCCTCGAGCAGCGGAAGTCAGTTCGTAGGTAGTTCCAGAGCTTC
ACGGCGTCAAATGACATGGATCGGACCGGTAATAGTTGCTCTAGGCTTCATAGCACAGTTTTAGCACCAAATCTTTAAACAAAAGTAAAACAATCGGGTG
TCAGTTTTTAGCTTTTCCCGCGGTAGATATAATTCCTATCCCACATGCTCCTGCATCCCACGCTCCGGCGTGTATCGCTTGTGCCGTCCACGCATCACTT
GCTGTCCGCACCACACACCCGAAAACGCTCTCCATCTCTACCATGCATCGCCTGCTCTCCGTTGTATTTCTATCTTTAATTGGAACGATCAGCGCTGCAG
AATGCACCGACAGCGAGGAGAAAAGTATCACGGACGCGTACGCCGCTGCCGCAGCGACGAGCGCCTGCTCCCCGTGGTCCAGTAGCAACATCATGATCCT
CATCGTCCCTCCCTGCTCCGCTACAGACTGTGTCGCAGTCATGCAGGACTTGGTCGAATCAATCTCGAACTGCACGACGTCCGGACTGTCAACCAGTGAG
AAGGATCAGCTCCTTCAGTCACTCGACATTTGCGCTACTCCAGCTCCTACACCTGCATCGACGGCTTCAATCACAAATTGCACCAGTTCAGAAGCGGAAA
CCACGTTCAACGCCTTCTACGAAGCTGCCAATGGCTCGTGTGCCGGTTCCACGACCTTCGAACACTACAGCATTATCATCGACACCCCGTGCACCTCGAC
GTGTGCTACAACAGTCCAAGACTTCGCTCAATCACTGCCGAATTGCAACTACGAGTTGTCGAACGAGAACACCAACAAGAAGCAAGACATCGCCACGCAG
TTCAGCTACTGCGAGATGCTGGACAACGCCACGAACATCAGCGTCTACGTGGACTCGGTCAACGATCTCTTGGGGTCTACAGACTCAGAGACGGCCGTTC
TTCCTAACTGCACCACGGAGGAGATCGAGGAGACTGTCGCGTTCTACTTGACCGTCGCAACCAACGAATCGTGCGTGTTCGACTCGTCCATCTGCGCCTA
CGACGTCCATTTGAATGCCGACTGTGACTCACCGTGCGGTCGCCTCATTCAACGTCTGGGATTCGACGTTCCGAGGTGCTACTTCGACCACATCAACCAC
CGAGAGAGGCTATCAGACAGCTACTACCAGTGCGACTGGATCGTGTTTCCTGAGAATATTTCCACCAGCTTCCACTACTCAGAGGTCTTGAACGCAACAG
GGAACACGTCGAATCGATGTGATCCCAAGTTTGACTCGACCGTCAGTAGCTCCGACGACGTGCTTGGAGGGAGCAGTGGGCAGGACGACAGTGCCGCCTC
CAAGTCACATCAAACCTTTATTTTGTCCACGACTGCGCTGATCCTAGCGCTGACATTAGCTTTGTAAAAGGAGACTTTAACCCCCCAAATGCAACTGATA
CGGGAACGGAT